Transcript

si:dkey-22l11.6-201

ID
ZDB-TSCRIPT-090929-1931
Name
si:dkey-22l11.6-201
Previous Names
  • si:dkey-22l11.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000011230 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000011230|OTTDARG00000009779|ZDB-GENE-041210-251 si:dkey-22l11.6|OTTDARP00000009659 DKEY-22L11.6-001 LG_ BX248111.7 Danio rerio protein_coding NOVEL, 1266 bp
ATGTTCCGTTGCCTCGGCGCCAAAGCCCAAAGGAAGGTTT
ACAGAATCCAGTCAGATTGAAGCAAGACACCACAGCCGGA
TTTCTGTACATCCATTTGCACAGTACTGTACAACAAGTTT
CCTTTGCTGAGTTCCTTGGTCAGGGGTTTAAACACATTTT
CTGTCCAGTACTGCAGTTGGAATTTTCCATCAACTTTTTA
TGGTGGCGCAGTGGGAAGCGCTCTCACCTCACAGCAAGAA
GGTCGCTAGTTCGATTCTCGACTGGATCAGTTGGCATTTC
TGTGTGGAGTCTGCATGTTCTCCCCGCGTTCTCATGGGTT
TCCTCCGGGTGCTCCGGTTTCCCCCACAAGTCCAAAGACA
TGCGCTATAGGGGAATTGGACAACCAATGTCCATGTCAAA
AAAGCTTCTTCAAGCTCTCTTTACTTACCTTGGTGAGGAT
GAGGCATGCCTGGTGAAAGAATACATGGGCAATCAAAAAG
AAGAATTTTTGAAGGACCTGACAAACACCGCCATGGCCAT
ATGTGTCATCAAAAAGGAAAGAGGAGATTATGAGGACATT
GGCATCGTTGTGGATGGAACAGTGATTATTGAACAGATAA
AATCTGTTGCACAAGCCTGTGCACTGATGTTGGGGGCAAT
TTATGTGCTTGATTTGGCCTACCCAAAAGAACTCAAATAC
TATTACGAGTTTGCCCAAAAAGTACTTGTGCAAATGAACT
CTGACAAGCTCTCCTCAAAGGTTCTCATACTGGAAAACAG
TGTGATACTGTAATTTTAAGCATTGAAGTGTTAATAAATG
CTCAACAACCAAATGTATATCATATACAAATTGCAGTTTA
GTGTAGGATTTGTTTAATAAGTGAATTCAGTTTTCTTTGT
GTGCAAAATTAATTAGCTGTAGGAACTTGTTTTAAATGGT
GTGCGTGTGTGTGTGTGTGTGTGTGTGAGAGAGAGAGAGC
ATGTGCATTCTATAAACTTTGTATTTATTCCATTTCATAC
AACTTGTAGTTGCTCAATTTGTTTTTTTTTTATTTTTTAA
GTTAATTAGTTGATTATTTTGTGTATTGGGGTGTGTGTGT
GTGTGTCATAAGGATTGCCGTTTGCTCCAAGACTTCATAC
AGTTTCTTTTATGTGTTGGTTTAAATTAAATGTGCTGTAC
AAACTGTTTATTGTGTTATGGTGTGCTGCTAAAGCATTTT
TAGGCAGTGATTTATGTTTTGTTAAAAAAATGCATCTTAA
AAAGTCATTAAAATGAATTCAAAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations