Transcript

foxl2a-202

ID
ZDB-TSCRIPT-110325-884
Name
foxl2a-202
Previous Names
  • foxl2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051092 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051092|OTTDARG00000035853|ZDB-GENE-060512-241 foxl2|OTTDARP00000040157 foxl2-002 LG_ CU571391.3 Danio rerio protein_coding KNOWN, 403 bp
AAACGATGGATGTTGTTCACACCTGAAAGAGCATTTAAAT
TCCACTCTTTGACTCGTGGTGGGGGCTTAACAAACCTGGT
TTGCGTGCGCAATGATGGCCACCTACCCAGGCCACGAGGA
TAACGGCATGATACTCATGGACACAACCTCGAGTTCAGCG
GAGAAAGACCGAACAAAAGACGAAGCTCCTCCAGAGAAGG
GACCGGACAAATCCGACCCGACCCAGAAACCACCGTACTC
ATACGTGGCGTTAATCGCGATGGCAATCCGCGAGAGCTCG
GAGAAGCGTCTTACGCTGTCCGGTATATACCAGTACATCA
TCAGTAAGTTTCCATTCTACGAGAAGAACAAGAAGGGATG
GCAGAACAGCATCCGACACAACCTGTCACTCAACGAGTGC
TTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations