Transcript

prdm9-202

ID
ZDB-TSCRIPT-110325-791
Name
prdm9-202
Previous Names
  • prdm9-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050690 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050690|OTTDARG00000035601|ZDB-GENE-040426-1319 prdm9|OTTDARP00000039803 prdm9-002 LG_ CR456629.17 Danio rerio protein_coding KNOWN, 453 bp
AGAATATGCTGCAGAAATCTGCTCCTGAAGCTGTTTAGTC
GACGTTTTTCACTCTTTCCTGCAGCTCTGGTTTCTCATCT
CGAACCACACCCAGTTGTAACAATTCTAAATGGAACTCTG
AGGATCCATGATGTCATCAAGGCTGACATTCCAAGCTCTT
TGCTGAAGCTGATTGGCTGATTGGAGTTTGAGGCAGTTCA
TGTGTGAAAAACGAGATTTGCCCCCAAGCGAGGAGCAGAA
TTTAGAGATACAGGGATCTGCTACTAATTGTTATTCTGTG
GTAATAATTGAAGAACAGGATGACACCTTTAATGACCAAC
CTTTCTATTGTGAGATGTGTCAACAACACTTCATAGATCA
GTGTGAGACCCATGGTCCACCTTCGTTTACATGCGACTCT
CCAGCGGCTTTGGGTACACCTCAAAGAGCTCTGCTAACAC
TGCCACAAGGCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations