Transcript

prdm9-201

ID
ZDB-TSCRIPT-110325-2606
Name
prdm9-201
Previous Names
  • prdm9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050689 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050689|OTTDARG00000035601|ZDB-GENE-040426-1319 prdm9|OTTDARP00000039802 prdm9-001 LG_ CR456629.17 Danio rerio protein_coding KNOWN, 2918 bp
ACAACTTCCTGTTTTGGGAAGCTTGGGTTCTTGTTCGTTA
CAAAGCTAGTAGGCTCGAATCACAACTTGGTTGTCCTAAT
GTGCATCTATCTTTTAGAAGTGAAAAGTGCGACTTACTGC
ATCTATTGAAGCAATGTCGCTCAGTCCCGATTTGCCCCCA
AGCGAGGAGCAGAATTTAGAGATACAGGGATCTGCTACTA
ATTGTTATTCTGTGGTAATAATTGAAGAACAGGATGACAC
CTTTAATGACCAACCTTTCTATTGTGAGATGTGTCAACAA
CACTTCATAGATCAGTGTGAGACCCATGGTCCACCTTCGT
TTACATGCGACTCTCCAGCGGCTTTGGGTACACCTCAAAG
AGCTCTGCTAACACTGCCACAAGGCTTGGTTATTGGTCGA
TCAAGCATCTCTCATGCAGGACTTGGGGTTTTCAACCAGG
GCCAAACTGTTCCTCTAGGGATGCATTTTGGGCCTTTTGA
CGGTGAAGAGATCAGTGAGGAAAAGGCACTGGATAGTGCC
AACTCTTGGGTAATTTGCAGAGGAAATAATCAGTATAGTT
ACATAGATGCAGAGAAAGACACTCACTCTAACTGGATGAA
GTTTGTTGTGTGCTCAAGGAGTGAGACGGAGCAGAATCTT
GTTGCGTTCCAACAAAATGGACGTATTCTGTTCCGCTGTT
GCCGCCCCATTAGCCCTGGTCAGGAATTTAGAGTTTGGTA
TGCTGAGGAATATGCTCAAGGACTCGGCGCCATCTGGGAT
AAGATCTGGGATAATAAATGCATTTCTCAAGGTTCAACTG
AAGAACAGGCAACTCAGAATTGTCCATGTCCTTTTTGCCA
TTACTCCTTCCCTACCCTTGTTTATCTGCATGCGCATGTG
AAGCGCACGCACCCTAATGAGTACGCACAATTCACACAGA
CACATCCGCTTGAATCTGAAGCCCATACACCCATCACTGA
AGTAGAACAGTGTCTTGTGGCCTCCGATGAAGCGCTTTCA
ACACAAACGCAGCCGGTGACAGAAAGTCCTCAGGAGCAGA
TTTCAACCCAAAACGGACAACCCATCCATCAGACTGAAAA
CTCGGATGAGCCTGATGCATCTGATATATACACTGCTGCA
GGTGAAATTTCAGATGAAATACATGCATGTGTTGATTGCG
GTCGGTCGTTTTTGAGATCTTGTCATCTGAAGCGACATCA
GCGCACCATTCACTCCAAAGAGAAGCCTTATTGCTGCAGC
CAATGTAAGAAGTGCTTTAGTCAAGCAACAGGGCTGAAAA
GACACCAGCACACCCACCAGGAACAAGAAAAGAACATTGA
AAGTCCAGACAGACCTTCTGATATATACCCCTGCACTAAG
TGCACCTTGTCCTTCGTGGCGAAGATCAATTTACATCAAC
ATCTCAAACGACATCACCACGGAGAGTACCTCCGATTAGT
TGAGAGTGGCTCACTTACTGCAGAAACCGAAGAAGATCAT
ACAGAAGTGTGTTTTGACAAGCAGGATCCAAACTATGAAC
CTCCTTCTCGAGGAAGGAAGTCCACAAAGAACTCTTTAAA
AGGCAGAGGTTGTCCTAAAAAAGTGGCTGTAGGCAGGCCT
CGAGGACGACCACCTAAAAACAAGAATCTGGAGGTTGAAG
TGCAGAAGATTTCTCCCATCTGCACTAACTGCGAACAGAG
CTTCTCTGATTTGGAGACGCTGAAAACGCATCAGTGTCCA
AGACGTGATGATGAGGGTGATAATGTAGAGCATCCACAAG
AAGCTTCTCAGTATATCTGTGGCGAATGCATTCGAGCTTT
CAGCAATTTGGATCTTCTCAAAGCCCACGAGTGCATCCAG
CAAGGGGAAGGATCTTACTGTTGCCCCCATTGCGACCTTT
ATTTCAACCGCATGTGCAATCTGCGTCGCCATGAGAGAAC
GATCCACTCTAAGGAGAAGCCCTATTGCTGCACGGTGTGC
CTCAAGTCTTTCACTCAGTCTTCTGGATTGAAACGCCACC
AGCAAAGCCACTTACGCCGTAAATCCCACCGCCAGAGCTC
AGCTCTGTTCACTGCCGCCATCTTTCCCTGCGCATACTGC
CCGTTCTCCTTCACTGATGAGCGATATCTTTACAAACACA
TCCGGCGCCATCACCCGGAGATGAGCCTCAAATATCTGAG
CTTCCAAGAAGGGGGCGTTTTATCAGTCGAAAAGCCTCAC
AGCTGCAGTCAGTGCTGCAAGAGCTTCAGCACGATCAAGG
GTTTTAAGAATCACAGCTGCTTCAAGCAAGGGGAGAAGGT
GTATCTGTGCCCGGACTGCGGGAAGGCCTTCAGTTGGTTT
AACAGCCTCAAGCAGCACCAGCGAATCCACACCGGGGAAA
AGCCTTACACCTGTTCGCAGTGCGGAAAGAGTTTCGTCCA
CTCCGGGCAACTGAATGTGCACCTCCGTACTCACACAGGC
GAAAAACCTTTCCTCTGTTCTCAGTGCGGCGAAAGCTTCA
GGCAGTCTGGAGATCTGAGGAGGCACGAGCAGAAGCATTC
TGGTGTCCGTCCGTGCCAGTGTCCGGATTGTGGGAAAAGC
TTTAGTCGGCCGCAGAGTCTCAAAGCTCATCAACAGCTTC
ACGTCGGCACTAAACTTTTCCCCTGCACTCAGTGTGGAAA
AAGCTTTACTCGGAGGTACCACCTCACCCGGCATCATCAA
AAAATGCACTCTTGATTCAAATAGAAATGCACGGACGCCA
CATGAAATGCTTTAAAACTTATTTAGTTTCTTTGTCGCTA
AATAGCTGTGATAGATTTTTGAGTTTAACACAAGTGGGCA
AGCACTTGTTGGATTGTAGATGCATTAGGCCGGTTGTAAT
CAAAAGTCCAAATTATATTTTATTAATGCCAAAATGTCTA
ATGGTATGTTAACATAGTAAAATAATTTTGTAAATGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations