Transcript

vax2-201

ID
ZDB-TSCRIPT-110325-739
Name
vax2-201
Previous Names
  • vax2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050423 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050423|OTTDARG00000035431|ZDB-GENE-030904-8 vax2|OTTDARP00000039580 vax2-001 LG_ CR457446.4 Danio rerio protein_coding KNOWN, 1099 bp
TGACAGGAACGAACTTCGCTAGACTATTCATTCCACCTCT
CATTTTAGCTCAAGAAAACTAAGTGGACACATAAACATAG
TTATAGTGTTAGATGTTTGATCAAGCCACGAGTATGGGCG
ATGGAATCGCCGAGGACCGAAACCACTGTGGATCCAATTC
GTTGTGCCGTGACCGCGGCAGAGAGTCGAAAAGCCGGACG
GAAGTGGGGAACCGGTCACCTGTGCAGAGCTCTACCGACA
CACCGGGGACTTCGGCATCCACACCGACCTCATCCAGCGA
GGATGGACACGATAAACTTTTAGGAGTCGATCCCGACTAC
TGTCGGAGGATTCTGGTCAGAGACGCCAAGGGCACTATTC
GGGAGATCGTGCTGCCCAAAGGGCTGGATCTGGACCGGCC
GAAGCGCACGCGGACCTCGTTCACGGCGGAGCAGCTGTAC
CGGCTGGAGCTCGAGTTCCAGCGTTGTCAGTATGTGGTCG
GCCGAGAGCGCACGGAGCTCGCCAGACAGCTCAATCTCTC
TGAGACACAGGTGAAAGTGTGGTTTCAAAACCGCCGCACC
AAACAGAAGAAGGACCAGACCAAGGACACAGACAAGCGCT
CATCATCCACCTCCGAATCCCTCGCCACATGCAACATCCT
GCGTCTCCTGGAGCAGGGGCGTCTCCTGTCGGTACCCGCG
CCTCCTCCAAACCCACTGCTGGCGCACCCACATCCAGGCA
ACGGCTCTCTGCTGGGCAGCCCGTCTGTGTCCACCTCCTC
TGGGGTGAGTAGCTCCACCACACCTCCCGGAGCTGGCAGC
GGGACGTTCGGACTGTCGCTGTCTTCTTTAAGTGGCACTC
CACCTTCACCGCGGCTGGGCGTCCCGCCGCCGTCCCTTTG
CTTTACCATGCCTCTCCTGAGCGGCGCACATCACGAACTG
CCATCGGGATACGGCTGCGGGACGTCAGCGTTCGAGCCCT
ACATGAGGATAGAGCGCAAGGATGGAGAGTTAGGAGGGAA
GAAGACGGTGTCCTAAAAGCGCTCCTGTAATCTTCTCCCC
TCTACCTGTCTCAGGGGTCTCACCTGTGCCGCGAACATCC
AATCGGATGAAGCGGAGGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations