header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-708
Transcript Name: per1b-201
Previous Name: per1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050284 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050284|OTTDARG00000035348|ZDB-GENE-040419-1 per1b|OTTDARP00000039468 per1b-001 LG_ CU672227.10 Danio rerio protein_coding KNOWN, 6777 bp
CGCTATCTTTGTGGACTACAGTCGCAAAAGGACGTCGTTT
TGAAATTGCGCAGGATTCATTACAGCAGGAGTACATTGTA
AAACTATTTCGATCTCTATATGATTATAGGAATTCGTCTT
GTCGTTCAACAGAAAACGAAGCAGTAAAATCCAAAAGGTG
ATCTCTGAGGAGAGCGGGTGACACAGAGGGCAAAGAGAAG
AAGAGTGCATGGACAAAGCCTAACAAGAAGCTTAATTTCC
CAGTGGCTGTTTCTTACACTTTCGCTCGCACTGTCACTCT
CCATCTGGCTTCATGTGTGGAGCCAAGTCTGTTTCATAAC
AACCAGTCTTGTCTGTTTTTCTGAGCCGAGCAACATTTTC
TCTGGTTTGCAAAATATCTTCCGTTCGTTTTGAGTTTAAA
CCGCTTCCAGTCGGAGGAGCCAAGTCAAAGAAGGGGGTGG
CGAGACACCCGAATACGCCATGATTCCTATTTATTTGATT
AATTGCACCAAGATGATTTCCCACTGCAGTTCAGGAAATC
CAACTTAGTGGACTCATTCAACTTTGTGTAATTCATTGTC
AGGTGGAAATCATCACCTTGGCAAACGCGTGTTCTTACAG
TATTATTATGAGTGATGACAACTCAGACTCCGCCCCCAGC
AATGATGCAGACAGCGGAGCAGGAGGGATAGAGAAAAAGG
CTGGGCGATCCTGTGGCATGAGCGAGAGCTCGCCCTCATC
AAATCCAGAGAGTAGTGGGTCAGGAGGGCTATCCGGTCCC
AAAGGATCTGCAGGTGGCAACCGAGGTGTGAATTCTGATG
ATACAGATGGACTGTCCAGTGGAAATGACTCTGGGGAGAG
GGAAAGTGAAGGAGGGATGCAGAGAGGGAGCGGATCCAGA
GGGAGACAGTCAAACAGAAGTTACCAGAGCTCCTCCAGCC
AGAATGGGAAAGACTCTGCCATGGGTATGGAGACAACGGA
GAGCAACAAGAGCTCAAACTCTCACAGCCCTTCTCCACCC
AGCAGCTCTCTGGCATACAGTCTGTTGAGTGCCAGCTCTG
AGCAGGACCCGCCATCCACCAGCGGCTGCAGCAGTGATCA
GTCTGCCCGCGTCCAGACTCAGAAAGAGCTAATGAGAGCT
CTGAATGAGCTGAAGATCCGTCTGCCGCCAGAGAGGAAGA
TGAAGGGACGCTCCAGCACCCTGAACGCCCTCAAATACGC
CCTCAGCTGTGTCAGACAAGTCAGAGCCAATCAGGAGTAT
TACCACCAGTGGAATGTAGAGGAGTGCCATGGCTGTAGTC
TGGATCTCTCCACCTTCACTGTTGAAGAACTGGACAATAT
CACCTCAGAATACACACTCAAAAACACAGACACATTCACC
ATGGCGGTGTCATTCTTGTCTGGGAAGGTTGTGTACATCT
CTCCGCAGGGCTCATCTCTTCTGCGCAGTAAGCCAGAGAG
GCTGCACGGGGTGTTGTTTTCAGAGCTGCTGGCTCCCCAA
GACGTGAGCACCTTCTACAGCAACACAGCACCCTGCAAAC
TGCCAGCGTGGGCCTCCTGCATCGGCTCTGTTTCTCCACC
AATGGAGTGCACCCAAGAGAAGTCCATGTTTTGTCGCATC
AGTGGAGACGTCTCATCCAGCAGTGATGTGAGGTACTACC
CTTTCAGACTGACCCCGTACCTGCTGACCCTCAGAGACTC
CGACATGGCTTTCCCTCAGCCCTGCTGTCTGCTCATCGCC
GAGAGAGTGCACTCGGGATATGAGGCCCCTCGCATTCCTC
TGGATAAGAGGATATTCACCACTAGTCACACCCCCAGCTG
TGTCTTCCAGGAGGTGGATGAGAGGGCAGTGCCTCTGTTA
GGATACCTGCCTCAGGACCTGGTTGGAACGCCGGTCCTGC
TGTGCATTCATCCAGATGACAGACACATCATGGTGGCAAT
CCATAAGAAGATTCTTCAGTTTGCTGGTCAGCCGTTCGAG
CACTCTCCCTTAAGGATGTGTGCGCGTAATGGAGAGTATA
TGACTATAGACACCTCTTGGTCCTCCTTCATCAACCCCTG
GAGCAGGAAAGTGGCCTTCATCGTTGGACGTCATAAAGTC
AGAACCTCTCCACTGAACGAGGATGTTTTCACGCCGCCGC
GCGGTCTGGAAGAGCGAGCCCTGACTCCAGACATCGTTCA
GCTCAGTGAACAGATCCACAGGCTCCTAGTTCAGCCCGTC
CACTGTGGCAGCTCTCAGGGCTATGGCAGTCTGCCCAGCA
ATGGCTCCCACGAGCATCAGCCCAGCGCAGCCTCTTCATC
AGACAGCAGCGGGCCTGGTGTGGAGGACCCCTCACAGCTT
CACAAACCTATGACCTTCCAGCAAATCTGTAAAGATGTTC
ACATGGTCAAGACAAGCGGACAGCAAGTCTTTATTGATTC
CCGCAACCGACCTCCTCCCAAAAAACATTCCACTGCAGGT
GCTCTGAAAGCAGGCGAGTCAGCAGAAGTGTGTAGAAGTC
TGATTCCTTGTGCTGCTCCACCCTCAAAGAGCTCCGCGCC
TTCACTAATCGTGCAAAAAGAACCACCAACAACATTCTCG
TACCAGCAGATCAACTGTTTGGACAGCATCATAAGGTATC
TTGAGAGCTGTAATGTCCCAAACACGGTCAAGAGGAAGTG
TGGCTCCTCCTCCTGCACCGCCTCCTCTACGTCGGATGAT
GACAAACAGCAGGAAGCTCCAGGCAACGCTAAAGGTCCGT
CTGTGTCTCTGGTAGATGACAGCGCTTTGTTACCTCCACT
GGCCCTGCACAATAAAGCCGAGAGCGTCGCCTCTGTCACA
TCCCAGTGCAGTTTCAGCAGCACCATCGTCCACGTTGGGG
ACAAGAAACCTCCTGAGTCAGATATCGTAATGGAGGAAGC
TCCTCCCACTCCAAATATTGCTCTGCCTGTCACTCAACCT
CAAGTTCCTCCCATGGCCACACCCTCTCTGCCTCTTAGCC
CTGCTCCTGATAGGGATGCTGGGAGAAGAGGAGGACCAGG
GGCTTCTGCAGGAGGAGAAAGGTTGGGTCTTACGAAGGAA
GTCCTGTCAGCTCACACACAACAAGAGGAGCAGAACTTCA
TGTGCCGCTTCGGAGACCTGAGCAAACTTAGAGTCTTTGA
CCCAACTTCAGCTGTCCGCCGACGACCAAATGCACCCTTA
TCAAGAGGTGTGCGCTGCTCTCGTGATTATCCAGCAGCAG
GCAGCAGTGGGCGCAGACGTGGTCGAGGAGGCAAAAGACT
GAAGCATCAGGAATCTTCAGAGCAAACAGGTTCTTGTAGT
CCAGCCGGACCAATAAGAGGCCTCCTCCCTGGAGTTCCCG
CTCTGGGCAGACCCTCTAACCCCTCCATACCCATGGGTCC
TACAGCCAGCTCCTCGTCCTGGCCCACATCAGGGTCACAA
GCCAGCGTTCCCAATGTCCAATATCCACCCACCGTCCTTC
CTTTTTATCCAGTCTATCCCCCAATCTCCCATCCCGTCTC
AGACCCCAGCATGCAGTCAGGCCTTCGCTTTCCCCTTCAG
AACTCACAAATGGCGCCTCCGATGGTCCCCCCAATGATGG
CATTGGTATTACCCAACTACATGTTCCCACAGCCCAGCGT
AGGCATGGCTCAGCCCTTCTTCAGCCCAAACTCAGCTTTC
CCCTTCGCCGCTGCCAACATGGGCTCGCCTGCTCCCTGTC
AGATCCAGACCCCAATACAACGCGCTCATTCTCGCTCCAG
CACACCTCACTCCTATAGCCAAAGAGAAAACGGTGCAGAG
AGAGAAGGAGCAGAGTCTCCCCTCTTTCAGTCCCGATGCT
CATCGCCCTTAAATCTGCTGCAGCTGGAAGAGTCGCCAAG
CAATCGGTTCGAGGTGGCGTCAGGACAGCAGACTACATCT
CCTATGGTGGGACAAGGAGGTGGAGCTGGAGGACAGGCCT
CGTCTAACCAGAGAGGGTCAGCGGTGGATTCAAAAACAAA
CGAAAATGGTGAAACAAATGAGTCCAATCAAGACGCCATG
TCCACCTCCAGTGATCTGCTGGACCTGCTGTTACAGGAGG
ATTCCCGCTCAGGCACTGGCTCGGCTGCCTCAGGCTCGGG
CTCTTCAGGCACAGGGTCCTCAGGCTCAGGCTCCGGTTCC
TCTGGATCCGGCTCCAATGGCTGCAGCTCTTCCGGGAGTG
GAACTAGAAGCAGTCAGAGCAGCAATACTAGCAAATACTT
TGGCAGCGTGGACTCATCAGAGAACAGTCATTCCCGCAAG
CAGACAGCAGAGGGCGACGGAGAGGCGCAGTTCATCAAAT
GTGTCCTTCAGGACCCCATCTGGCTCCTCATGGCCAACAC
AGATGAAAAAACTATGATGACCTACCAGCTGCCAATAAGA
GACAGAGATTCAGTGTTGAAAGAGGACCGAGCTGCGCTGA
GAGCCATGCAGAAACATCAGCCTCGCTTCACTGAAGAACA
GAAGAGCGAGTTGAGTCAGGTTCACCCATGGATCCGCACC
GGACGCCTTCCTCGTGCCATTAACATTTCAGCATGTGCAG
GCTGTAGATCCCCTCCTTCAGTCCCCTCTGCGACACCATT
CGACGTGGAGATCCACGAGATGGAGTTCTGCAGTGTTTTA
GCGGTGGCGGAAGAGAAACAAACCCCTGCAGATACAGTTA
TGGAGAAAAGCGAAACTGACGGACAAAATGAGACATGCAA
AGAGAACAATGGGACTGTTACGACAGCACAAATCAATGAT
CAAGAAATGCTGACGGAAGAACAGGAAATGACCTCGCAGA
TCGAGGAAGAAATGGGTGCCTCACATACACAGATGACACA
CTAAAGACACTACGAGCCAGTGCGATGCCGGTGACATCCT
TTGTGTACTCGTTAAATTGTCCTGTTGTATTTATTTTTAT
ACACGAATGCAAATTAGCCAGGAAGGCTGACAGATGATGA
ATGTAAAGCAGAAGTGCTTTTCGAAAGACTGTGATGTCAC
AATTTTTGGCTCCCACGAAGAGGTTGTGGTCTGTTTGCAA
GCTCGATTTGGGCGGAGATATGGAATACTTCGCTTTAGCC
CACTCTGGATTTGACCTCAAGACGCCACCTGTTCAGTTCC
ATCTCTAGAGACCCGCAGAAACCCGTTTCGTGGCGTCCTG
AACTTTCAGATGTTGTTCAATGGGAAAAGGAGCGTTCACA
GCTAGAGCGACAGCTATGACGATAACTATAAGATTTTATA
AATCAAGCAAAATCTTGGAGAATATGATATTCTACATCAA
AACTATAATGATAATAACCAAACGAACAATAGTGCTGGTA
TTTCCACATAGTTTTGTCAACAATTGAAGACGATTGGACG
ATTACCGGCGACACCAGTGGTCATTAAGGGAACTGCAGCC
TTGTGCACATATAATAAAAAAATTGTCTAAAATTCTTTTT
AGATGAATATGTTTACACTCTAATAAAACAAACGCATAAC
ACAAATGAAAGCTGTGAGCAAACATGATCATCGCAATATG
GATATGTTTGCACCAGCTTTGCATTTAATGTGAACAGACG
AAGTTTATTTGAGACTATAGAATATATAGATCATGTTGAA
TGAATACCATTCTTTCAATGACACATTGGCATTATGCTGA
ACATTCCAAGCATTTGCTTCATGTGTCATACACTCTCAGA
AATATGAGAGCTGTCACTGGGGCATTACCTTTTCAAAAGG
TACTCATTTATACCTATAGAATCCACAGTTGTACCTCAAA
GGTACATATTAGTACTCCAATGCACCTAAAATGTATCTTT
GAGGTGCCAAAATGGACCCTTTAGGTACAAATATGTGTAG
AATGTCACATTCTTTCGATATTTTATTATGCATTTATTAA
TTTCAGGCCAAATGTCCCATTTTTTGAGACGTAAATCCAC
ATATAAACTTTTCATACCGTTTAATTAAAACACAAAACAA
GTTCTTACATATAACACCTTTAAGAGATAAGCACTATTCA
ATAAAACAAGCATTATTGTCTATTATTACTTAACAAGTAA
TAACTTCTAATAAAACAAGCATTAGCATTCATTGATTATG
GATGTTAATGAAGTTATCGATATAGGTATCACCCTTGTTG
TGAAGGGACCTTCAAACTCTGTAATGTGGAGCTGTTTTAA
GTGTTGTGAGACGTGTCCTTACACAGCAGAACAGATTCAC
TGCCTTTGAGGACAGTCTAACTGTTCCTCGCTTTGTGCTT
TTTGACATTTCCAAAAAAAAGTGATGGAAATGTAGGTTTT
TTTACAGTTGTAAAAAGGATTTTCTGACCAAATTTCACAT
GATTTTGTTTTATTTGTGTCTTTCTGTATATATTTTTATA
CTTTTTTTGGTGCAGAATTGTTAAAGCTTGGATGAAATGC
ATTGCGGCTCCTGTTACCGTTCACTTTCACCTCTAGATCA
CATTTAGACCACCAAAACCGTCAACTTTTCAACGAGTATT
AGTAGCTCAAGGCGTTTTGTAGAATAGCAAAGAAGTTGAA
AGAATGGAGGGCTTGAATAGTATACTATGTGAAAACTGTA
TCATCAAAGTGAACCGGGTTTAAAGGAACAATTCACCCCA
AAAAAATTTGCAGAAAAAAAGATGCATTTTTCCAGGGTGA
ACTGTGCTTTTAAGCGATACATGTAAATTAAGTCGGATGC
ACTTTCCTCTTGTTTGACTTTTCCTCTGTGTCAGCTTCAG
TCATGTGCTCCTTGACTTCAAGTTGTCTCGGAACAGTTTG
TAAGTATTTTGTGTATTTCTTTGTACATGAAAAGAATAAA
AAAGAATATGATTCATA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
per1b-201 Contained in:

OTHER per1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050284 (1)
  • Ensembl_Trans:ENSDART00000011082 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY597250 (1) 6818 bp
    GenBank:BC163718 (1) 5063 bp
    GenBank:CA472463 (1) 876 bp
    GenBank:CT625733 (1) 806 bp
    GenBank:EB930078 (1) 724 bp
    GenBank:EB932591 (1) 663 bp
    GenBank:EB890686 (1) 598 bp
    GenBank:EB911399 (1) 414 bp
    CITATIONS (2)