Community Action Needed: Please respond to the NIH RFI
Transcript

ddx4-205

ID
ZDB-TSCRIPT-110325-649
Name
ddx4-205
Previous Names
  • ddx4-002
  • vasa-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050058 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050058|OTTDARG00000035216|ZDB-GENE-990415-272 ddx4|OTTDARP00000039292 vasa-002 LG_none BX571726.9,CU855689.3 Danio rerio protein_coding KNOWN, 2519 bp
CATAGCTGGCCATCTTTCTTTCTCTCGCGAGGCTCTTCAC
GCGTGTCCACCTGCTACCGGCTCTTCTGAAAAAAAGTCTC
ACCTAAAATTACCCAATATGGATGACTGGGAGGAAGATCA
GAGTCCCGTTGTGTCTTGCAGCTCAGGATTTGGAGGTGCT
GGAAATGACAAGTCAAACAGTGAAGGTACTGAAGGTAGCT
CATGGAAAATGACTGGTGATTCGTTCAGGGGGAGAGGAGG
CAGGGGAGGATCACGAGGAGGCAGAGGAGGCTTTAGCGGT
TTTAAATCAGAAATTGATGAGAATGGCAGCGATGGAGGTT
GGAACGGAGGTGAAAGTCGAGGAAAAGGACGTGGTGGTTT
CCGTGGTGGTTTTCGCAGTGGCTCCCGTGATGAAAATGAT
GAAAATGGAAATGATGATGGTTGGAAAGGAGGTGAAAGCC
GAGGTAGAGGTCGAGGTGGTTTCGGGGGTGGTTTTCGTGG
AGGTTTCCGTGATGGTGGTAATGAAGACACTGGGAGAAGA
GGCTTTGGAAGAGAAAATAATGAAAATGGAAACGATGAGG
GAGAAGGCAGAGGAAGAGGTCGTGGTGGTTTCCGGGGTGG
TTTTCGTGATGGTGGTGGTGATGAGAGTGGAAAAAGAGGC
TTCGGAAGAGGAGGTTTTAGAGGCCGGAATGAGGAAGTAT
TTTCCAAGGTCACAACTGCAGACAAGTTGGATCAAGAAGG
AAGTGAAAATGCAGGACCCAAGGTTGTTTATGTGCCGCCG
CCTCCTCCAGAGGAGGAGAGCTCGATATTCTCCCATTATG
CAACAGGCATTAATTTTGACAAATATGATGATATTCTTGT
GGACGTGAGTGGCAGCAATCCTCCAAAAGCAATTATGACT
TTTGAGGAAGCAGGACTTTGTGACTCACTGAGCAAAAATG
TATCAAAGTCTGGATATGTGAAGCCTACACCTGTTCAGAA
ACATGGCATTCCCATCATTTCAGCTGGACGGGATCTAATG
GCTTGTGCTCAGACTGGATCAGGAAAAACGGCGGCCTTCC
TGCTGCCTATCCTACAGCGCTTTATGACTGATGGTGTGGC
AGCCAGCAAGTTCAGTGAGATACAGGAGCCTGAGGCCATA
ATCGTGGCTCCCACCAGAGAACTTATCAATCAGATCTATC
TGGAGGCCAGGAAGTTTGCATACGGGACCTGTGTACGACC
TGTTGTGGTTTATGGAGGTATAAATACTGGATATACTATC
CGAGAGGTGTTAAAGGGCTGCAATGTTCTGTGTGCTACTC
CTGGAAGATTGCATGACCTCATTGGTCGTGGAAAGATTGG
CCTGAGTAAAGTGCGCTATCTAGTTCTGGATGAAGCAGAC
AGAATGCTGGACATGGGCTTTGAGCCAGAAATGCGCAAAC
TGGTGGCGTCTCCTGGTATGCCTTCAAAAGAGGAACGACA
AACCCTCATGTTCAGTGCCACCTACCCTGAAGATATTCAA
AGAATGGCTGCTGACTTTCTTAAAGTGGACTATATTTTCC
TTGCTGTTGGTGTGGTGGGTGGAGCATGCAGTGATGTGGA
GCAAACCATTGTTCAGGTGGACCAGTACTCAAAGAGGGAC
CAGCTGCTTGAATTGCTCAGAGCAACAGGTAATGAGCGCA
CAATGGTTTTTGTGGAAACCAAAAGAAGTGCTGATTTCAT
AGCAACATTTCTCTGTCAAGAGAAGATCTCAACCACAAGC
ATCCATGGTGATCGGGAACAGCGAGAGCGAGAGAAAGCTC
TCAGTGATTTTCGCCTTGGCCAGTGTCCAGTTCTGGTCGC
CACATCTGTAGCTGCTAGAGGCCTGGATATTGAGCAAGTC
CAGCATGTTGTGAATTTTGACATGCCCAGCAGCATCGATG
AGTATGTCCATCGCATAGGAAGAACTGGACGCTGTGGGAA
CACCGGTCGCGCCGTGTCCTTTTTTAACCCAGAGTCTGAC
ACTCCATTAGCTCGCTCCCTGGTCAAAGTCCTTTCAGGGG
CCCAACAAGTAGTTCCAAAATGGCTGGAGGAAGTTGCCTT
CAGTGCTCATGGGACAACAGGCTTCAACCCACGTGGGAAG
GTGTTTGCATCTACAGACTCGCGGAAGGGAGGATCCTTCA
AGAGCGATGAGCCGCCACCATCACAAACATCTGCCCCGAG
CGCAGCAGCTGCTGCAGACGATGAGGAATGGGAATAACTG
GCCTCACACCTGTTATATTTATTTTATTTTTATTTTATTT
GTGCGAGCTTCTTCAATACCATTTCAGGATATTTGTTAAT
GTTGAATGACTAAAGTAGCATTAGGATAAAGCTGTTGTAT
TTAGAGTCACATTGAATGCTGTAGGTTTGACCTCAAGGAC
GATAATCAAGACTAATACCTTTTGGCAGTTTAATTTGATC
ATCTTTTTGGTATCACTCGTTTTGACTGGAGCACATCTGA
AATAGTGGATTTGTTTTACTAGAGCACAAGTGCAGAAGTG
GGTGGGTTTGTTTAATCACATTTTAACACTTTGCTAGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations