Transcript

ddx39b-201

ID
ZDB-TSCRIPT-110325-62
Name
ddx39b-201
Previous Names
  • bat1-001
  • ddx39b-001
  • ottdart00000046038
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046038 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046038|OTTDARG00000032881|ZDB-GENE-040426-1259 ddx39b|OTTDARP00000036326 bat1-001 LG_ FP085397.6 Danio rerio protein_coding KNOWN, 1928 bp
AGATTCGTCGCGAGTTGATGACGTTGTAGACAATCTATCT
GGCAGGTGCAGTCAAATCCAACTGCTTCAAACAGTGTTTC
GAGAATGACAGAGAACGATGTTGATAACGAGCTGTTGGAC
TATGAGGAGGATGAGGTAGATGCTGGTGGTGCAGGGGACG
CAGGCCTTGGACACAGCGATGGCATCATATCCATCAGGAA
AGAAGGCGTCAAAGGGTCATATGTGTCCATCCACTCCTCA
GGGTTCAGAGATTTCCTTCTCAAACCAGAACTCCTAAGAG
CGATAGTGGACTGCGGATTTGAACATCCATCTGAGGTTCA
GCATGAATGCATTCCTCAGGCCATCTTGGGAATGGATGTT
TTATGTCAGGCCAAGTCTGGAATGGGGAAGACAGCTGTCT
TTGTGTTGGCCACCCTTCAGCAGCTGGAGCCTGTGACTGG
TCAGGTGTCAGTGCTGGTGATGTGTCACACACGAGAGCTG
GCATTCCAGATCAGTAAAGAGTACGAGCGCTTCTCTAAAT
ACATGCCCAGTGTCAAGGTGGCAGTATTCTTTGGTGGTTT
GTCCATAAAGAAGGACGAGGAGGTGCTGAAGAAGGAGAGT
CCTCATGTGGTGGTGGGAACTCCTGGACGGATTCTAGCTC
TGTCCCGCAACAAGAGTCTCAACCTGCGCCACATCAAACA
CTTCATTCTGGATGAATGTGATAAGATGCTGGAGCAACTT
GACATGCGTCGGGATGTCCAAGAAATCTTTCGAATGACCC
CTCATGAGAAGCAGGTCATGATGTTCAGTGCCACCCTGAG
CAAAGAGATCCGTCCTGTCTGCAGAAAGTTCATGCAAGAT
CCGATGGAAATTTTTGTGGACGACGAGACCAAGTTGACAC
TTCACGGCCTCCAGCAGTACTACGTCAAGCTGAAGGACAA
CGAGAAGAACAGGAAGCTCTTTGATCTCCTGGATGTGTTG
GAGTTCAACCAGGTGGTGATCTTTGTGAAGTCGGTGCAGC
GTTGTATTGCTCTCGCTCAGTTGCTGGTGGAGCAAAATTT
CCCTGCCATTGCCATTCATAGAGCAATGCCCCAAGACGAA
AGACTAGCTCGATATCAGCAATTTAAAGATTTCCAGAGAA
GGATCCTGGTAGCCACTAATCTGTTTGGCCGAGGTATGGA
CATCGAAAGAGTCAACATTGCCTTTAACTACGACATGCCT
GAAGACTCTGACACGTACCTGCACAGGGTTGCACGGGCTG
GCAGATTCGGAACAAAAGGTCTGGCCATCACCTTTGTGTC
CGATGAAAATGATGCCCGCACTTTGAATGACGTTCAGGAC
AGGTTTGAGGTGAACATCAGTGAACTTCCAGAGGAGATTG
ACATCTCATCATACATTGAACAAACACGATAAAGATGACA
ACACTAAATGCAGGAGTTTCTTCAGAAGGATGCATGGGAT
TGTAGCATTTGATAGCAATTGAGTTTGTATTTCACTGTTC
CAGTGTTAGTGAATACTTCTATGGCTCACATCGCTGCGTT
ATCCAGTATTGTGGTGGTTTCCTGACGCCTTCTTGGTTTC
GTTTTTGCTTATTGAAAGTTAATAAATGCAATATTTTGTT
TTTTATGACTTTTTTTCCTTTCGATATGAATTATTTTGTG
TTTGGGATGTTTGTTTTTACTTTGTTTTTAATGAAGAGAT
ATACTTTATCATTTCTGTTGTGAGAGGAAGAGTTCTCATT
TTTGGATTATAATGGGCTACACAGTTGACTGCAGTGAAGT
AGAATTGATCAAAAGTTACTAAATATATTAGCAGTGTATG
CTGAATGCTTGTTACCAGTGGAGTAGGTATTTAAAACAAT
GTTTGTTCATTCAGTTGTCAACTGGCAGGCCACTTTGTTT
AAACTACTCAATGCTTGTTAAACCAAATAAAGTATTGTTT
GATTTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations