Transcript

ddx39b-002

ID
ZDB-TSCRIPT-110325-1366
Name
ddx39b-002
Previous Names
  • bat1-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049256 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049256|OTTDARG00000032881|ZDB-GENE-040426-1259 ddx39b|no_translation bat1-002 LG_ FP085397.6 Danio rerio protein_coding KNOWN, 413 bp
TTGCCTTTAACTACGACATGCCTGAAGACTCTGACACGTA
CCTGCACAGGGTTGCACGGGCTGGCAGATTCGGAACAAAA
GGTCTGGCCATCACCTTTGTGTCCGATGAAAATGATGCCC
GCACTTTGAATGACGTTCAGGACAGGTTTGAGGTGAACAT
CAGTGAACTTCCAGAGGAGATTGACATCTCATCATACAGT
GAGTGTTAACATTCAAACTTTAAAATGTACAGAACAAGAT
GAGAACATTTCTATATAGGAAATCAAATCGATAAATAATT
CAGTTCTCCACATACGAACTACATAACAATGGACTAAAAA
CGAAAGCATTTCATTTGATTTTTGAAAAGTGTTTGGGTTA
CAGATGATCTGTATTATTGAGGTCTGCAGTACTTGGTCAG
TATCTTGACTAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations