ZFIN ID: ZDB-TSCRIPT-110325-502
Transcript Name: smyhc2-204
Previous Name: smyhc2-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049401 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049401|OTTDARG00000028722|ZDB-GENE-070822-12 smyhc2|OTTDARP00000038755 smyhc2-003 LG_ CU929259.18 Danio rerio protein_coding KNOWN, 970 bp
AAGCTCACATCATTGTACCACCTAAAGGACTTGGATTTCA
TCTGGCGAGGCACACTTTCATCTGATTGACTGAAAGATGG
GGGATGCTGTGATGGCAGAGTTTGGGCCTGCGGCTCCGTT
CTTACGTAAATCAGATAAGGAGCGTCTGGAGGCCCAAACT
CGTCCTTTTGACATGAAGAAGGAGTGTTTCGTGCCTGATC
CCGAGGTTGAGTATGTCAAAGCCTCCGTCACCAGTAGAGA
CGGTGATAAAGTCACTGTTGAGACTGAATTTGGGAAGACC
GTCACTGTGAAGGAGGTTGACTGTCACCCTCAGAACCCGC
CAAAGTTTGATAAGATTGAGGACATGGCGATGTTCACCTT
CCTGCACGAGCCTGCTGTGCTGTTTAACCTCAAAGAGCGT
TACGCAGCCTGGATGATCTACACCTACTCTGGCCTCTTCT
GTGTCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAA
TCAGGAGGTGGTCGTTGCCTACAGAGGAAAGAAGAGGACT
GAAGCTCCTCCTCACATCTTCTCCATCTCTGACAACGCCT
ACCAGTACATGCTGTCAGACAGAGAAAACCAGTCTGTCCT
GATCACTGGAGAATCCGGTGCTGGAAAGACTGTGAACACT
AAAAGAGTAATCCAGTACTTTGCCAGCATTGCAGCAGCAC
CAGGCGGCAAAAAGGATCCATCACAGGAGAAAAAGGGTAC
TCTGGAGGATCAAATCATCCAGTGTAATCCTGCTCTGGAG
GCTTTTGGTAATGCCAAGACCATCAGGAATGACAACTCCT
CGCGATTTGGTAAATTTATTCGGATCCATTTTGGAGTCAG
TGGAAAGTTGTCTTCTGCTGACATTGAGACTTGTAAGTGC
TCAACTGCCCAACATCCCCCTTATGAAAAATAAGTTTATT
CAAGTGTGCTGTAATTATATTTATTTTAATAAAAAAACAC
AGTCTTTCAA

smyhc2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA smyhc2-202 (1)    Ensembl 5975
smyhc2-204 970
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
smyhc2-204 Contained in:
[BAC] CH211-24N20 (1)

Genome Resources: Vega_Trans:OTTDART00000049401 (1),  Ensembl_Trans:ENSDART00000164582 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC150362 (1) 989 bp
CITATIONS (2)