Transcript

slc39a5-201

ID
ZDB-TSCRIPT-110325-49
Name
slc39a5-201
Previous Names
  • slc39a5-001
  • ch211-66i15.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042684 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042684|OTTDARG00000030750|ZDB-GENE-060608-1 slc39a5|OTTDARP00000033897 CH211-66I15.8-001 LG_ BX957355.14 Danio rerio protein_coding NOVEL, 2252 bp
AAACACTAGGATACTACGAGGAAACTGGAGATCATGTAAC
AGGCTTAAGAGACCGCAGAAAATCATGGGTGGACAGACAG
TCTGGATGACTCTGAGCTTCAAGCTTCTGCTCTACTACTG
TATGATATCTTTGTTAATGCCAGCCATCTTCATACTGGCT
ACACGTGCCCAGGTCGACAAGTTCAGAAAGTTTAATGAGA
GTACACAAACCAAATCTTCACAGGAACTCTTTGAGGAAGC
ATTTGAAGAGCAGGGCTACTACTTGCAACGTCTGTTCCTT
CAGTATGGAGACAATGGGACTTTGACATATGAGGGTCTAC
AGAAGCTGCTTGGTAGTTTGGGTTTGGGAGAAGTCAGTGT
CCTGGAGATTCGACATGGTGAAGCAAAACATCCTTCTCAA
TCGATATCCCATTCCCACTCACATGAAGACCATCACCCTT
CTCAAGGGACTACAAACTCACCTCCACTCAGAGAAAGTCT
GGATGCTAAATCAGCGCTCAGTGGCTCTCCGGCAGAATTG
GGTCGCTCAGACTATTTTCTACACCCCGCTCTAAGAAACA
AACAGGAGGAAAGTGTGTCACTGCTATCTGACCATCCGAC
AGAGAAACACCTTCATGGCAATTGTCTGAATGTGACCCAG
CTCCTCTGGAACTTCGGGCTTGGCCAGGCGTCCCACATCA
CTCCTGCCCACTTCACCTTCCTGTGCCCTGCCCTCCTGTA
CCAGATCGAGAGCGGAGTGTGTCTGCGGCACACAGAAGAT
CATTCACAGGCCAGCAAAACCAGCGAGGGCTTCCTCATAG
CTCTAGGATGGGCATCATTGGCGCTCCTGGTCATCAGCCT
GCCCTCTCTGGTTGCTCTGGGAATGGCACCGCTGCTTCAG
CCTTCTGTACTTCAAGTGTTTCTCTGCCCGATGGCTGGCA
TGGCGGTGGGCACGCTCTGTGGAGATGCCCTTCTGCACCT
CATGCCTCATGCCATCTTCAGTCAACACACTGATCACCAG
AATGCTGTTTTCAAAGGTCTCAGTGTTCTGGGAGGACTTT
ACCTTCTCTTCATCTTTGAGAGTCTTCTGGGACTTAAGCA
GCATTTCAAGAATTTAAAGAGAAGAAAGCATGACGCAGAG
TGTGGAAGAGAGCTTGACGCACTACAGGGAACCTCATCAG
CCAATCAGAATGAGAGTTCAGGGCACGGTCATTCCCATGG
ACAGGCTGAACCAGGGCAAACTGGTATCAGAAGCATGGCA
TGGATGGTGGTGATGGGTGATGGCATACATAACCTGACAG
ATGGACTTGCCATTGGTGTCGCGTTTTCCCAGAGTTTGAC
TGGCGGCTTCAGCACCGCGATCGCCGTGTTCTGCCACGAG
CTTCCTCATGAACTAGGTGATTTGGCGGTGTTGTTGTCTG
CGGGCTGGCCTGTGCGCAGGCTGCTGGTGTTCAGCGGGCT
CTCTGCTCTGCTGGGTTTTGTGGGTGTTTTGGCCGGATCT
GCGCTGGGGAACCACTGGGCTTCACACTCACCCTGGATCC
TCACACTCACCGCCGGTGTCTTCCTCTATGTAGCTCTTGC
TGACATGATGCCGGAGATGCTGCACGGAGCCTGTGGATCA
GTGAGTCCGCTGAAGCGCTTCCTCCTGCAGGCTCTCGGCC
TGCTGACAGGGGGCGCCATCATGCTGTGCATCGCGCTCTT
CGAGGATCACATCGCTGTCAGTCTGGGAGAAAACAGTCTG
GGAGAAAACTAACAACATGATGAAGATCATCTAAATCAAA
GACACAAGCATTTTCGAGTACCTCATCCATTATATCAACT
ACTGTGTAGATGTGGATATTCTGAAGAAAGTTCCCCGGAT
GATGGATTTGCTATTGTAACTGCAACAAAGATTTATAGGT
AGTCATTATTTTTGAACATCCACTTCCTAACGTGTTTATA
AAGAAAAAAAACTAGCCTATAAGGTGAATGCTGTGTTTTC
AGTTTGTCTTTCATTTATCATATAAATGTTTCTCAACATA
AACATTAGTTTATTTATGATGTTGAAGACGGTTGTTAAAT
GATAACGTCGTCACTGTTTACATTTGTACTATTAATATAT
AATGCCCTTCCCTTGTTTGTTTGTAGACTAGGCCTATAAC
TTCATAGCCTTTTTAGAATTTTATATTGTTAAATAAAATC
ACAATTACCTCCAGGTATTAAAATGTAAAAACACAGAGAA
ACTGTTTTAAAGAACTTTGCACAGTAAATAAAAACCTCTA
TATTTTCCTTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations