header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2680
Transcript Name: smyd1b-202
Previous Name: smyd1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050998 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050998|OTTDARG00000035794|ZDB-GENE-060522-1 smyd1b|OTTDARP00000047923 smyd1b-001 LG_none CU683892.9,CU469500.10 Danio rerio protein_coding KNOWN, 1819 bp
CCCATGCTGAACCCTGACATGGTACAGCTGAAGACTGGTC
TATTTGAGACGCAGCCGCTGGGCATCAGTGCAGACGCTGA
AGATCCAGAATGGAGTTTGTGGAAGTTTTTGATTCTCCAG
GGAAGGGCCGCGGGCTGAGGGCCACCAAAGAGGCTTGGGC
TGGAGACGTGCTGTTCGCTGAGCCACCCTTCGCTTCTGTG
GTGTTCGACAGCCAGGCGTCCAGCATCTGTCACAGCTGTT
TCCGGCGTCAGGAGAAGCTGCAGCGCTGCGGACAGTGCAG
GTTTGCGCAGTACTGTGACAAAACATGTCAGCGCGCCGGC
TGGGAGGAACACAAGCTGGAGTGTGCTGCCATCAAGACCT
ACGGAAAACCGCCGAGTGAAAACGTCCGTCTGGCGGCCCG
TATCCTGTGGCGTATGGATAAGCAGGGCAGTGTGGTGTCC
GACAATCAGCTGACGACTCTGGAGGATCTGGAGGATCACA
TCTGCGACATCTCAGAAGACGACCTGAAGGACTTTAAAGT
GGACATCCACAACTTTCTGGACTACTGGCCACGCAACAGC
AAACCGCACACGGTGGACAGCGTCTCGCACATCCTCGGCG
TGATCAACTGTAACGGGTTCATGGTGAGCGATCAGCGCGG
CCTGCAGGCGGTCGGTGTGGGGTTATTTCCCAATCTGTGT
TTGGTGAACCACGACTGCTGGCCCAACTGCACTGTCATCC
TCAACAATGGAAATCAGTCGGCCATCGATACTGTGTTTCA
CTCTCAGAAGAGGATTGAGCTGCGTGCTCTGGGAAAGATC
AGTGCGGGTGAAGAAGTGACGGTGGCGTATGTGGATTATC
TGAACGTGTCTGCAGACCGCCAGCGTTTGCTAAAACAGCA
GTATTTCTTTGACTGCACATGCAAACACTGCACAGAGAAA
ATCAAAGATGACCTGAAGATGGCCGGAGCTGAGGTGGATG
GAGTCAAGGTGCCGGAAGAGCAGGTGAAGGAGGTCACAGA
GTTCAGCAGACAGAAGCTGGAGAAGATGGAGAAGGCCAGG
ATAGAGGCCAACTATAATGAAGTGGTGAAGATCTGCCGTG
AGTGTGTGGAGAAACAGGAGAATGTTCTGGCCGACACACA
CATCTATTATCTGCGTGTGTGTTGTACCCTCAGTGAGGTG
CTGTCCTACCTGCAGTTCTTCGATGAGGCGTCCGAATATG
CCCGCAAGATGGTGGACGGATACCTGAAGCTGTATCACCC
TAATAACGCTCAGCTGGGGATGGCCACGATGCGCGCGGGC
GTCACACACTGGCAGGCAGGCTTCATCGAGGTGGCACATG
GGATGATCTGCAAAGCCTTCGCCATCCTGATGATCACACA
CGGACCCACACACCCCATCACTAAAGACCTGGAGGCCATG
CGCATGCAGACGGAGATGGAGCTGCGCATGTTCCAGCAGA
ACGAATACGTTTATCACTCGATGCGCGAAGCGGCGCTCAA
AAACCAGCCAATGAGGATGATGGCGGAGCCAACCAATGAG
GGCATCAAGAACCTGTTCCGCAGGAAGTGACATCACACAA
CTTCCTGTCCACAGTGACAGACACGCTCAGGTCAACGCTA
CACACACACATAGTTACGTGTTTATTATTAGACACTTCTG
TTATTCATTTACAAACGGCTATTTTATATTATATTATATT
ATATTATATTATATTATATTATATTATATCTGCCGTTTTC
AGGATTGATGAATGTGTTTTAGGTTTTTTGTAGCTTGTTT
TTGAGTGTTGTTTTTATTTTCTTTTTCTTTTTTGTAATTA
AAGATTTATGAATTTAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
smyd1b-202 Contained in:
[Fosmid] ZFOS-335G10 (1)

OTHER smyd1b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050998 (1)
  • Ensembl_Trans:ENSDART00000170737 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC115351 (1) 1775 bp
    GenBank:BC163095 (1) 1552 bp
    GenBank:DQ323979 (1) 1461 bp
    CITATIONS (2)