Transcript

smyd1b-202

ID
ZDB-TSCRIPT-110325-2680
Name
smyd1b-202
Previous Names
  • smyd1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050998 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050998|OTTDARG00000035794|ZDB-GENE-060522-1 smyd1b|OTTDARP00000047923 smyd1b-001 LG_none CU683892.9,CU469500.10 Danio rerio protein_coding KNOWN, 1819 bp
CCCATGCTGAACCCTGACATGGTACAGCTGAAGACTGGTC
TATTTGAGACGCAGCCGCTGGGCATCAGTGCAGACGCTGA
AGATCCAGAATGGAGTTTGTGGAAGTTTTTGATTCTCCAG
GGAAGGGCCGCGGGCTGAGGGCCACCAAAGAGGCTTGGGC
TGGAGACGTGCTGTTCGCTGAGCCACCCTTCGCTTCTGTG
GTGTTCGACAGCCAGGCGTCCAGCATCTGTCACAGCTGTT
TCCGGCGTCAGGAGAAGCTGCAGCGCTGCGGACAGTGCAG
GTTTGCGCAGTACTGTGACAAAACATGTCAGCGCGCCGGC
TGGGAGGAACACAAGCTGGAGTGTGCTGCCATCAAGACCT
ACGGAAAACCGCCGAGTGAAAACGTCCGTCTGGCGGCCCG
TATCCTGTGGCGTATGGATAAGCAGGGCAGTGTGGTGTCC
GACAATCAGCTGACGACTCTGGAGGATCTGGAGGATCACA
TCTGCGACATCTCAGAAGACGACCTGAAGGACTTTAAAGT
GGACATCCACAACTTTCTGGACTACTGGCCACGCAACAGC
AAACCGCACACGGTGGACAGCGTCTCGCACATCCTCGGCG
TGATCAACTGTAACGGGTTCATGGTGAGCGATCAGCGCGG
CCTGCAGGCGGTCGGTGTGGGGTTATTTCCCAATCTGTGT
TTGGTGAACCACGACTGCTGGCCCAACTGCACTGTCATCC
TCAACAATGGAAATCAGTCGGCCATCGATACTGTGTTTCA
CTCTCAGAAGAGGATTGAGCTGCGTGCTCTGGGAAAGATC
AGTGCGGGTGAAGAAGTGACGGTGGCGTATGTGGATTATC
TGAACGTGTCTGCAGACCGCCAGCGTTTGCTAAAACAGCA
GTATTTCTTTGACTGCACATGCAAACACTGCACAGAGAAA
ATCAAAGATGACCTGAAGATGGCCGGAGCTGAGGTGGATG
GAGTCAAGGTGCCGGAAGAGCAGGTGAAGGAGGTCACAGA
GTTCAGCAGACAGAAGCTGGAGAAGATGGAGAAGGCCAGG
ATAGAGGCCAACTATAATGAAGTGGTGAAGATCTGCCGTG
AGTGTGTGGAGAAACAGGAGAATGTTCTGGCCGACACACA
CATCTATTATCTGCGTGTGTGTTGTACCCTCAGTGAGGTG
CTGTCCTACCTGCAGTTCTTCGATGAGGCGTCCGAATATG
CCCGCAAGATGGTGGACGGATACCTGAAGCTGTATCACCC
TAATAACGCTCAGCTGGGGATGGCCACGATGCGCGCGGGC
GTCACACACTGGCAGGCAGGCTTCATCGAGGTGGCACATG
GGATGATCTGCAAAGCCTTCGCCATCCTGATGATCACACA
CGGACCCACACACCCCATCACTAAAGACCTGGAGGCCATG
CGCATGCAGACGGAGATGGAGCTGCGCATGTTCCAGCAGA
ACGAATACGTTTATCACTCGATGCGCGAAGCGGCGCTCAA
AAACCAGCCAATGAGGATGATGGCGGAGCCAACCAATGAG
GGCATCAAGAACCTGTTCCGCAGGAAGTGACATCACACAA
CTTCCTGTCCACAGTGACAGACACGCTCAGGTCAACGCTA
CACACACACATAGTTACGTGTTTATTATTAGACACTTCTG
TTATTCATTTACAAACGGCTATTTTATATTATATTATATT
ATATTATATTATATTATATTATATTATATCTGCCGTTTTC
AGGATTGATGAATGTGTTTTAGGTTTTTTGTAGCTTGTTT
TTGAGTGTTGTTTTTATTTTCTTTTTCTTTTTTGTAATTA
AAGATTTATGAATTTAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations