Community Action Needed: Please respond to the NIH RFI
Transcript

map2k6-201

ID
ZDB-TSCRIPT-110325-2609
Name
map2k6-201
Previous Names
  • map2k6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050698 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050698|OTTDARG00000035605|ZDB-GENE-010202-3 map2k6|OTTDARP00000039810 map2k6-001 LG_none AL954682.6,CU467923.7 Danio rerio protein_coding KNOWN, 1734 bp
TGGTTTCTTTGCAGAGCGGTTGCAGAAATCCCCCCGTTTT
CGTTGCGTGCAATTGAAAGAGCAGCCTTTGCACGGAGAAC
AAGTTTACCGACGCCCAAAGGCTCCGAGTGCATGAAGATC
GGGGCTTGTATTTTGCACCTTTGTTGCAAGCAAGCCCGCT
TGAAGCCTCACTGCGAGGGATAGATGGAAGGAGGGAGCGA
CAAGGAAAGCAAAGTCTTTTGTGATTCCCCTTCCCCCAAC
CCTAAAGGGGAGATGTCCGTGCCAAGTAACGTTAGAGGTA
AAAAGAAGCTTCCAAAAGAGCTCAAGCTTCCAAAAGAGGT
GTTCGAGAAACCGGCACCTGCTCCTACACCCCCGAGAGAC
CTGGACTCCAAAGCCTACGTTACCATTGGAGAAAAGAACT
TTGTGGTGAAGGCTGATGATTTGGAGCAGATTGGAGAGTT
GGGACGAGGGGCGTATGGAGTGGTGGACAAGATGAGACAC
GTCCCCAGCGGTGTAATAATGGCAGTAAAGCGGATCCGGG
CCACAGTAAACACACAGGAGCAGAAGCGGCTGCTAATGGA
TCTGGACATCTCGATGAGAACAGTGGACTGCTTTTACACC
GTCACCTTCTACGGGGCCTTGTTTAGAGAGGGCGACGTGT
GGATATGCATGGAGTTGATGGACACTTCTCTGGATAAGTT
TTATAAGCAGGTGCATGAGAAGGGAAAGACCATCCCGGAG
GACATCCTGGGCAAGATCACAGTCTCTATTGTGAAAGCAT
TAGAGCATCTCCACAGCAATCTGTCAGTCATACACAGAGA
CGTCAAACCATCTAATGTCCTGATAAACATGCAGGGTCAG
GTGAAAATGTGTGATTTTGGTATCAGTGGGTATCTTGTGG
ATTCAGTGGCAAAGACGATGGACGCCGGCTGCAAACCATA
CATGGCGCCTGAGAGAATCAACCCAGAGACCAATCAGAAA
GGCTACAATGTCAAATCCGATATCTGGAGTTTAGGTATTA
CAATGATCGAGCTGGCGATTCTGCGGTTTCCCTATGACTC
ATGGGGGACGCCATTTCAGCAGCTAAAGCAGGTGGTGGAG
GAGCCATCGCCTCAGCTGCCCGCCGACCGATTCTCTGCCG
ACTTCGTGGACTTCACATCACAGTGCTTAAGGAAGAATTC
CACAGAGCGACCGACTTATACAGAATTAATGCAACATCCC
TTCTTCACTCTCCACGACTCCAAAGACACAGACGTGGCAA
GTTTTGTGAAGACCATCCTCGGGGACTGAGAGTGTTCCTG
TGGGCCAAACTGACACACCACCGCCACCACCGCCGGGGGG
AGAAACGGGACTGTTCCAGAAAATACAAAACAACAAAAAA
CGAAAACATCAATCGCAAGACTTAACACCTGTCAAACATG
ACAACTGTGCGCAGGACGGAAGAACCACGGGCCGTGTGCA
TGTATGAGTGAGCATCGCCTGTGTGTGCAGACTTTAAAAG
GTTTTACAGTCCCAAGTCAAAAAAACAACAACAACTTCAG
TCGTTCAATCTCAGCTTTACCTCTAAATTAAAAACACAAT
CAGTTTTAGCATCCGGTGATGAGTCTGTTCTAGTTGTCTG
TTGAGATTTTCTCCCAGTCGCACATGAAATGTATTTTTCC
CCAAAAAAAGTCATCAGAAATGTTCCTCGCCCCCATCGAC
GCCCGGTTCTTTAAAAAAATAAAAATAAAAACGTAAATAT
TAAAAAAAAGAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations