Transcript

igdcc3-002

ID
ZDB-TSCRIPT-110325-2583
Name
igdcc3-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050560 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050560|OTTDARG00000035521|ZDB-GENE-080303-24 igdcc3|no_translation igdcc3-002 LG_none CU329666.7,CR318636.11 Danio rerio protein_coding KNOWN, 1560 bp
TTGGTTGGTTGGTTGGTTTGGTCGCGATGAGGAGAGACTG
AGAGCGCGAGATGCTGCTGCTACTGACACATTCCTTGAAA
GATGTGTAAAATGGCGCAAGTATGTTGAAGCCACCGGCTG
TAGTTTATTTCAAGAGGAGCTGATTTCTTCCTTCCCCATC
CTTGTCTTCGCTCTTGCCTCACCTTCTTTTATTGCATTTC
GTCTAATTTTCAATGTGATTAAATGGCTTCCGGACGGCGC
CGCCAGGCTCCATGCTCTCTCGGAATACTCCTGCTCGCTT
TTGTCGGTCTGACCTGTGGGGCTGAGCTCTCCTTCACCCT
GGAGCCAAGTGACATCATCGCGGTCCAGCAGCAGCCTCTG
ATGCTGCACTGCCAGGTAGAGGGAATCCCACCCATCAGCA
CCCAGTGGAGGCGTAGTGGAGCCCTCGTCCAGGAGGACCA
CAACTATGTCATGTTCACCAACGGCTCACTGCTGATCACA
CACTTCCAGAAGATCAAGACTGATGGCTCATCGGATGAAG
GAGACTATGAGTGCATCGCGCAGAACTTCTTCGGTCTGGT
TGTGAGCCGAAAAGCCAGAGTTCAGGCTGCTACAATGGCA
GATTTTCATGTCCAGCCAGAGTCAGTGCGTGCAGACGTGG
GAGGAGTTGGCCGATTTCAGTGCCAAATTCATGGCCTGCC
TGAGCCGGTCATCAGCTGGGAGAGAGACGGGCGGCCTGTG
GACACCTCTGATGAGAGGTTTACTCTGTTGCCCACGGGTG
TGCTGCAGATAACGGGTGTACGGCCTGAGGACAGTGGGGT
TTACTGCTGTGTTGCCCACAACAGTGCTGGAGTCAAACAC
AGCGCAGGAGCACAGCTCACAGTCTCAGGCTCCCAGTCAT
CTGTTTACAAAGAACCCATGATCCTAGTAGGTCCTGAAAA
CCTCACCCTTACGGTTCACCAGACCGCCATCTTGGAGTGT
GTTGCGACGGGTTACCCTCGTCCAATCGTGTCCTGGAGTA
GACTGGATGGACGGCCAATAGGAGTTGAGGGCATCCAGGT
ACTAGGAACAGGAAACCTGATGATCTCTGATGTGAGAGTT
CAGCATTCTGGCGTTTATGTCTGTGCGGCAAACAAGCCAG
GAACACGAGTGCGCAGAACTGCTCAGGGACTCCTAGTTGT
GCAAGCCCCAGCAGAGTTTGTGCAGCCCCCTCAGTCTATT
GCTCGTCCTGTGGGCACCACTGCCATCTTCACCTGTCTGG
CCCAGGGTGAGCCGGTCCCCCAGATCACCTGGCTGAAAAA
TGGACAGATCCTAGAACCTGATGGCCATGTCAAACTCAGG
AACAATAACAGGTGAGCTGAAGAGACTCGCATGTATGTAA
TGATGTTTGTATGCAATGTCATTTTATGCTATAGTGTCTA
CACTTTTTATTTCTTCATCTTTAATTCATGTTTATTTCTA
TAGCGCTTTTACTATGTAGATTGTGTCAAAGCAGCTTAAC
ATAGAAGTTCTAGTGGAAACCATATAATTTTGCGATATAT
TTCTACACACAAAAGCGTTTCATTGAAAACAATCCTGACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations