Transcript

igdcc3-201

ID
ZDB-TSCRIPT-110325-1675
Name
igdcc3-201
Previous Names
  • igdcc3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050559 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050559|OTTDARG00000035521|ZDB-GENE-080303-24 igdcc3|OTTDARP00000039695 igdcc3-001 LG_none CU329666.7,CR318636.11 Danio rerio protein_coding KNOWN, 2778 bp
GCGAGATGCTGCTGCTACTGACACATTCCTTGAAAGATGT
GTAAAATGGCGCAAGTATGTTGAAGCCACCGGCTGTAGTT
TATTTCAAGAGGAGCTGATTTCTTCCTTCCCCATCCTTGT
CTTCGCTCTTGCCTCACCTTCTTTTATTGCATTTCGTCTA
ATTTTCAATGTGATTAAATGGCTTCCGGACGGCGCCGCCA
GGCTCCATGCTCTCTCGGAATACTCCTGCTCGCTTTTGTC
GGTCTGACCTGTGGGGCTGAGCTCTCCTTCACCCTGGAGC
CAAGTGACATCATCGCGGTCCAGCAGCAGCCTCTGATGCT
GCACTGCCAGGTAGAGGGAATCCCACCCATCAGCACCCAG
TGGAGGCGTAGTGGAGCCCTCGTCCAGGAGGACCACAACT
ATGTCATGTTCACCAACGGCTCACTGCTGATCACACACTT
CCAGAAGATCAAGACTGATGGCTCATCGGATGAAGGAGAC
TATGAGTGCATCGCGCAGAACTTCTTCGGTCTGGTTGTGA
GCCGAAAAGCCAGAGTTCAGGCTGCTACAATGGCAGATTT
TCATGTCCAGCCAGAGTCAGTGCGTGCAGACGTGGGAGGA
GTTGGCCGATTTCAGTGCCAAATTCATGGCCTGCCTGAGC
CGGTCATCAGCTGGGAGAGAGACGGGCGGCCTGTGGACAC
CTCTGATGAGAGGTTTACTCTGTTGCCCACGGGTGTGCTG
CAGATAACGGGTGTACGGCCTGAGGACAGTGGGGTTTACT
GCTGTGTTGCCCACAACAGTGCTGGAGTCAAACACAGCGC
AGGAGCACAGCTCACAGTCTCAGGCTCCCAGTCATCTGTT
TACAAAGAACCCATGATCCTAGTAGGTCCTGAAAACCTCA
CCCTTACGGTTCACCAGACCGCCATCTTGGAGTGTGTTGC
GACGGGTTACCCTCGTCCAATCGTGTCCTGGAGTAGACTG
GATGGACGGCCAATAGGAGTTGAGGGCATCCAGGTACTAG
GAACAGGAAACCTGATGATCTCTGATGTGAGAGTTCAGCA
TTCTGGCGTTTATGTCTGTGCGGCAAACAAGCCAGGAACA
CGAGTGCGCAGAACTGCTCAGGGACTCCTAGTTGTGCAAG
CCCCAGCAGAGTTTGTGCAGCCCCCTCAGTCTATTGCTCG
TCCTGTGGGCACCACTGCCATCTTCACCTGTCTGGCCCAG
GGTGAGCCGGTCCCCCAGATCACCTGGCTGAAAAATGGAC
AGATCCTAGAACCTGATGGCCATGTCAAACTCAGGAACAA
TAACAGTACTCTGACCATCTATGGAGTGACCCAGGAGGAT
GAGGCCATATATCAGTGTATAGCAGAGAATAGTGCGGGGT
CCACGCAGGCCAGTGCTCGACTGACCGTTCTGTGGGCTGA
TGGGTTGCCAGGCATGCCCACAGACATACAAGCAGATGCC
CTTTCTCCCACCTCCATTCAGGTCACCTGGAAAGAGCCTA
CCCAAAACACTCAGGACATAATTGGATATGTGCTCCATAT
CCGCAAGACTGCTGACCCAGTGGAAATGGAGTACCAGGAG
GCTGTGAGTAAAATGACCCTGCAGCAGGTAATTGGAGATC
TGGAGCCTTCCACCAGCTACAGCTTCTATGTGAAGGCCTA
CACGTCCCGCGGAGCCAGCAAAGCCTCTGAGACCACTGTG
GAGAGCACTCTGGGAGAAGTCCCTGCTCCACCAGCCTTGT
TCACCAAGGTGATTAATTTGACGGTGATTCAGGCCACATG
GGAGGCCTCCACTAAGATGGGCCAGCAGGAAGGATTCAAT
CTCTACTATCGTAAGGTCCCCGTCCCTCAATTCACAGGAC
CCCTCACCTTCCCACGAGATGTGATGCAATACAACATCAC
TCAACTAGATCCTTCTTTTGTGTATGAAATTAAGATTCTG
GCTTTTAACCAGCATGGAGAAGGCAATGCCACCCTGCGCT
TTGTCTCACTGAAGGAAGCAGTGGAGAAATCAGTGCTAAA
CACCCCTTGCGACTGTGTAAAGGACGAACAGAATAAAAGC
TCCACCACAGGCATCATCATCGGCATCCACATAGGAGTCA
CTTGCATCATTTTCTGTGTCCTATTCCTCATGTTCAGCTA
CAGGGGCAGGTTGATGATGTGTAAAACCGTGCAGGCATCC
AGACAGGCGGGCAGGAACCCAGCAGCAGGAGTCGTGCTGG
AGTCCTCCTCCTCACAGGGGGCTCTCAGCGGCCCCCACAG
GTTCAGCCCAGATGGGAATGGAGGAGCGCACAATGCAAAG
AGCTGTACCGACTCCAACGAGATGGAGAGACTCTTCTCAG
GACCATCCCACTACTCCCATCCACCTGACACCACCCACAC
AATCGAGAGCTCTCTGGTCTCCTGTCCACTGAATGAAACT
GAAATGTCTACTCTTCCCCTGGATGATTTCAGTCTGGCGG
AGGAGTGCGAGTTGCAGTTCTGCCGGCATCCAGCAGAGGG
CCAGCGGGATGAAGACTGAAAAAAAAATTACGAAGGCCAA
GAATATCCTCCACTCAGACTCCTGTCCAACTCAGGTCAAC
TGAAAGTATTCATCTTTTTTTTTTTGTTTTGTTTTTATTG
TGCAAAGAGTATATTATTCATAAGTTAAGTTCCCTTGTGG
GAATCACTGGACTGTATGCCGAAGGTCCCTCTGGCCTCAA
AGTGGGTGAAGTTCTGAGATGGACTACTGTTATTTCTCAT
TGGTAGGTGAACGAATACACTCTTACATTGACAACTGGCA
GCAAGTCTTCAGTCACTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations