ZFIN ID: ZDB-TSCRIPT-110325-2568
Transcript Name: fgf3-201
Previous Name: fgf3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050485 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050485|OTTDARG00000035472|ZDB-GENE-980526-178 fgf3|OTTDARP00000039632 fgf3-001 LG_ CU896555.9 Danio rerio protein_coding KNOWN, 1887 bp
GAGCATGAAAAGAGAATTAACAGTGGCTCACCCAGAGGCC
AGTGTTCATGCTTAAATATAATTTTCGGACCTTTCAAACG
AAGCAAACTCTGCCCTTGGATGTCTCTCTCTTTGTGATGC
GGTTTTCCGCTGTAAGCCACCGTGTGTAGTGCTGTGTAAT
TTTATCCACGCTGCAACCTCTTGGTTCACACAAGACTGAT
AGCCTACCTTGCCTCCCCTTTTCCTTTGTATCAATTGGTC
GGGGTTTGGGCTATTGTTGCAGGAGGGCTCTTTTATTTCT
GTGCACACTGTCGATCAGCGAAATCTCACGATAGGCTCCC
TGTGAAACCGACTGGCTCTTTTCTCCTCCTCGGTCAGATA
CAGTTTGCTTGGAGAGCAGAGTGGAACCCATGAGCACCGA
CGAGGCGAACCCATGCTGTTGCCACCAAGCCGGCTCTAAC
AGATGACCGCGGCGTATTAAACAGAGGACATAGGGATACA
GCAAGATTTTATTTTAATGTTCGGCTAACTGGATCACTGA
CAAATGATACTTCTTTGATGGGACCCCGTGCGCCAGCTCT
TTCTATTCCAGCGAGATTTTGCCGACATCCCGCCATGCCA
CAATGGTTATAATTCTGCTCTTGTTGTTACTGAGCTTCTT
GGATCCGAGTTTGGAGGAATCTCTGGCTCCGAGGCTGACC
AGGACCCCAAGGGCGCCTTGTGCCAGGGGCCAGGCGTGTG
ACCCAAGGCAGCGGCGAGATGCTGGTGGACGCGGCGGGGT
TTACGAGCACCTCGGAGGAGCTCCAAGACGTAGGAAACTT
TACTGCGCCACAAAATATCATTTGCAAATTCACCCGAACG
GGAAAATAGACGGATCTCTTGAAGAAAACAACCCTTTAAG
TATACTCGAGATCACAGCCGTCGATGTTGGTGTGGTGGCA
ATCAAGGGACTGTTTTCGGGAAGATACCTGGCTATGAATG
AGAAAGGACGTCTCTATGCTTCAGAAGTCTTCAACCGAGA
GTGTGAGTTTCTGGAGCGCATTCATGAGCTAGGCTACAAC
ACTTATGCATCACGGCACCATGCAACCACCCAGCCTCCTC
CAACAGGGTCCGGCATAGGAGGCAGCAAACGCCGTGCCAG
TTCTAAAAGGCAGTGGTATGTGTCCATCAATGGAAAGGGA
CGGCCCAGGAGGGGCTTTAAAACACGGAGCACGGACAAAG
CTTCCCTCTTCCTGCCCCGAGTTCTGGCCAACAAGGACCA
TGAGATGGTGCGCAAGCTTAGAGAGAGTCAGCGGCACCAC
ACAGGCTCTCATAGGGCCCCTGTCGGTCGAGCAGAGCGCA
GGAGACGACGACACAGGGGCTCCAAGGGCCACAACAGAAG
GGCTGACATTTAACTCTCTCTTGACACAGATGGAGATCCA
AGGCCACTGAGAGTCCAAAAAAAAAGAGTCACATGGAACA
ATTTTCTTGGGAGAGGATGATTTCGAAGAAAACCTTTTGA
GGAATTACATGGCAAGAAGAGCGAAGAGATTCTCGAAAAT
AATAATAAAAAAGACAGTCCAAATAGGCTCATGTGACCAA
ACACAACACTACTGAAAGACGTGTAATTATTGTACATAAC
TGTATAGCAATTTACTCTTTTATTTGAGCAAAATAGCAGA
GTAAATGTTTGTAATCACAGATTAGGATGTTATACAAGTG
CTTGACAGTGTTGATGATGTGTTATGTATCGGCTTTATAG
GTGATGTACAGACAAGCACTTTTTCCTTATCAAAGTATAG
TAGAAAACAAAGATCCACACACATAAAACAGATGCTTTTT
AACGTACATGTGATAGGCTACTGTTCTTAAACTGCAATCA
GGAGTACTTTGTATATTACTAATGTAATACATATTTATTT
TTGTTTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fgf3-201 Contained in:
OTHER fgf3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050485 (1)
  • Ensembl_Trans:ENSDART00000168474 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH584169 (1) 993bp
    GenBank:BC162856 (1) 849bp
    GenBank:BC162895 (1) 849bp
    GenBank:BG985562 (1) 679bp
    GenBank:FP172472 (1) 549bp
    CITATIONS (2)