Transcript

abcc12-201

ID
ZDB-TSCRIPT-110325-2524
Name
abcc12-201
Previous Names
  • abcc12-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050286 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050286|OTTDARG00000035350|ZDB-GENE-050517-25 abcc12|OTTDARP00000039470 abcc12-001 LG_none BX323060.5,BX323797.10 Danio rerio protein_coding KNOWN, 4775 bp
GAAAAAAAAGACTGGGGTTTCTGCATCCGACAGGTGGTAA
CAGAGAGAGAGTGTGAAGGAGTGTCGAGCCCTCTGCTCGT
AATAACCTTTGAGCCTGGTAAAATTGTGATGTAACTCAGT
GTAAGGACCTTAAAGCACGTTGCTGCCGGAGTATTAAGGG
ATTCATGTTTAGCCTGACAACTACACTGATCAGTGCACAA
CTGGTAAAAGATCTTGAATAATAACCACCAGAAACTACTA
TAGTAAAAATGAAGGACTTCCCTTCAGAAAAACAGAAAGT
TGAAGGAGTTTCTTTTAAACAAAGAAGAGATAGTTCATCT
GCCATGAGTGCCTTTCCAGAAGGTCCCCCGGTTCTAGATT
ACAGGGAACCAGAACCTCCACCTAAGAAGCACAAGTACCA
ACAAAGCTTGAAAACTCTCATCCCATTTCGTTTTGCGTCA
AATTCACACCCGGTTGATGATGCTGGATTCTTCTCCTTCA
CATCGTTTTCATGGATGACACCCATGATGTGGAGGCTCTT
CCGAAATCGATTAGATGAAGACTCTCTTTTCCTCTCCCCT
CATGATGGAGCTCACATCAATGGAGAGAGATTCCAGAGAC
TGTGGGATGAAGAAGTTGCCCGTGTGGGTCTTGAGAAGGC
GTCTCTTTCTGCCGTGATCATGCGTTTTCAGAAGACAAGA
TTTATAGTGTCATTCTTGGCCTCTGTCATGTTTGCTTTTG
CTGTATTTGTTGGTCCGTCAATTCTAGTATATGAAATCCT
GAACTATGTCGAGCAGTCTGAACCGTCTACAGTGGTGCAT
GGTGTCGGTGTGTGTGTGGCTCTTTTCCTCACGGAGTTCA
GCAAGGCATTTTTTGCATCCGTCCTGTGGGCTGTGAACTT
GAGGACAGCTGTGAGAGTGAAGGGAGCATTCTCCATGCTT
GCTTTCAAGAAAATCATCTCTCTTAGGAGTCTTACTACTA
TCACTGTAGGAGAGACGATAAACGTCTTGACGAGTGATGG
CTATCGGTTGTTTGATGCGGTCATATTTGGGACATTTCTG
CTGTGTGTTCCAGTACTGCTGATCATCTGTATCATATATG
CCTGCTTTATTCTTGGATACACAGCACTTATTGGAATTCT
AGTGTATTTGATCTTCCTTCCAATACAGTTCTCTATCGCC
AGGCTGATCGGTGTGTTCAGAAGGCGGGCTGTATCTGTGA
CAGATAAACGAGTTCGCACCATGAATGAGGTTCTGACTTG
CATCAAGCTCATTAAGATGTATGCATGGGAGGAGTCTTTT
GAGAAGTCAATCACAGACATCAGGAAAAACGAGAAGCTGC
TATTACAAAAGGCTGGTTATGTTCAGAGTTTAAACTCTTC
TTTAACGACGATAGTTCCCACGCTAGCGACCATCGTCACC
TTCATCGTCCACACATCACTGAAACTGCCACTTCTACCTT
CTACTGCCTACACTATCATCGCTGTATTTAACTGCATGAG
GATGTCAATGGGCTTGTTGCCATTCTCTGTTAAAGCTGTG
GCTGAGGCTAAAGTGGCTCTAACTAGACTCAAGAGGATCA
TGCTGGTTCAGAACCCCAAAGGTTATCTTACTCAGGATAA
AAATATGGATTTGGCACTGGTCATGGAAAAGGCCACATTC
TCCTGGAGTCCAACAGATGACAAAAACACCAGCCAGATGC
CTGAAAACCCCTCTCAAAATGGCAAACACAAGGCAGAGTC
TCAACCGTCACTCAGAAACATCAGCTTGACTCTTTCAAAG
GGAAGTTTGCTTGGGGTGTGTGGAAATGTCGGAAGTGGAA
AAACCTCTCTGATATCAAGTATTCTCGAGCAGATGCATCT
TCTGAGTGGATCTGTATCAGCAAATGGAACATTAGCATAC
GTTTCCCAACAAGCCTGGATATTCCATGGGACTGTACGAG
ACAATATCCTTATGGGAGAACCATTTGATGAAGCCAGATA
TGCCAGTGTTATTAACGCTTGCTGTCTAAAGCCTGATCTG
GCTATACTTCCATATGGAGACCAGACAGAGATTGGAGAGC
GAGGTATTAATCTTTCAGGTGGTCAGAAGCAAAGGGTCAG
TTTGGCCAGGGCAGTGTATTCTAACAGAGACATCTTCCTT
TTGGATGATCCTCTGTCTGCTGTCGATGCACATGTTGGGA
AGCATATATTTGAAGAATGCATCAAGAAAGAATTGAAAGG
CAAATCAGTGATCCTGGTCACTCATCAGCTGCAGTATTTG
GAGTTTTGTGATGAAGTCATGCTGTTGGATAATGGGGAGA
TAAAGGAGGCTGGAACTCACAGTGATTTGATGAAAACTAA
AGGCCGCTACTCTCAGCTTATTACCAATGTGCATCTGGAA
CAGAATAACGAAAGAGCTGATTCCAAACCACAAACTGAAC
ACAATGATTCTGAACAGACCAATCCAGATGAGCCCAAAGC
CAATGGAATTGAAAACCCAGCGTTTGATATGTCTGATGAG
AAACCTGCAACAAACGAAACACCCAAAGACTCTTCAGAAA
CAAAAGGGAAAAAGGATCAATTAGTGACACGAGAAGTGGC
CCAAGAAGGTTCAGTTACGTGGAGGACTTACCATCAATAC
TGCCAAGCAGCTGGAGGCTATATACTGTTGTTTCTTGTTG
TCCTTCTCTTCACGCTTCTTGTGGGATCGACTGCTTTCAG
CAACTGGTGGCTCAGCTACTGGTTGGACCAGGGATCAGGG
AACAATTCCAGCTCTAATGCAACATCAAACAGCGGTAATA
TCTCTGAGAATCCGGACCTGTCGTTCTACCAAATGGTTTA
TGGTGTTATTATCATTGCCATGATCGTGCTGAGTATTCTC
AAGGGCTACACCTTCACTAAAGTCACTCTGCGTTCCTCTT
CCAAACTCCATGACACCATGTTCAAACGGATCCTTGGCAG
CCCAATGAGTTTTTTTGACACAACTCCAACTGGCCGCCTG
GTGAACCGCTTCAGCAAAGACCAAGATGAAGTGGATGCAG
TTTTGCCGTTCAACATGGAGAACTTTCTGCAGTTCTGTCT
GATTGTTACGTTCACTCTTCTCACCATCTGCATAGTCTTC
CCATTCCTTCTGATCGCCGTGGTCATTCTCGGACTCATCT
TCGCCACAATCCTATATGTTTTCCAAAGAAGCATCCGTCA
TATGAAGAGAATGGAGAATGTGAGTCGTTCCCCTTGGATT
TCTCTCACCACCTCTACCATACAGGGGCTCAGCACCATCC
ATGCCTACGACAAAAGGCAACAGTACATTGAACGGTTTAA
GATGCTGAGTGACAATAACTCCAACCATTTCATGCTGTTT
AATGCTGGAACCCGTTGGCTGTCATTCTGGTTGGATGTCC
TGTCTGCTACTGTTACTCTAATAGTGTCACTATTTGTTGT
GCTCAGCCCCAATGAGACCATAAACCCTTCTCTGAAAGGT
CTGGCCTTGTCTTACACCATACAGTTGACTGGAATCCTTC
AATTTGTGGTGCGATTGTCCACCGAGGTGGAGGCGAAGTT
CACCAGCGTAGAGAGACTGCTGGAGTATATTACGAGTTGT
GTTTCAGAGGGTCCACGAAGAGTCAAGGATGCCAACATCC
CTGCCGGTTGGCCACAAGAGGGCACCATTACCTTTAAAAA
CTACAGTATGAGATATAGAGACAACACTCCAATAGTCCTT
GATAATCTCAACATAACTATTAGGCCAGGGGAAAAACTCG
GCATTGTGGGACGCACTGGCTCTGGGAAATCTTCTCTGGG
TGTAGCATTGTTTCGTTTGGCAGAGCCGGCTGAGGGCACT
ATTTTAATAGATGATATGGACATCTGCAAACTGGGGCTCA
AAGACCTTCGCAGTCAACTCTCGGTCATACCACAGGATCC
TGTACTCTTCATCGGCACCGTCAGGTATAACCTGGACCCT
TTTAACAACTACAAAGATGAAGAGCTTTGGCTGGCTTTAG
AAAAGACCTACATGAAGGATACGATTTCTAAGCTGCCAGA
GAAGCTGCAGTCTCCTGTAGTGGAGAATGGAGAGAATTTC
TCTGTGGGCGAGCGGCAGCTCATGTGTATGGCCAGAGCAC
TGCTGCGCAACTCCAAAATCATTCTGTTGGATGAAGCGAC
AGCTTCGATAGACTCGGAGACTGACAGCTTGATCCAGCAC
ACCATTAGAGATGGTTTCCAGCACTGCACTATGCTCACAA
TCGCCCACAGAATCAACACAGTACTGGAGAGTGACCGGAT
ACTCGTCATGGACCAGGGCAAGGTGATTGAGTTTGATCCA
CCGCAGGACCTGATTCAGAGACCCAACTCTTTATTTGCAT
CACTTCTAGCAGCAGCGAATCAAGTCAACACGTGAAGCTC
TCACAAACATTCACATTCTCTTCTAGACATGCATTCAAAT
CTCATACATTTATTCAGGAAGTCAACCTGAAGGAGTTTAC
CACATCTTTTATACAGAACATTTGTGACTTCATACCTCAA
TCTTAACATATATGCTATCAATAACATGCCAGAGCACACT
TCACACGTTTGAACTGTACATTAACAGGTAAAAGCACATG
GATTTGCACTTTTTTATATAAAGTAAGCTGCACAGTAAAT
TTTTCTCCAGAGATTCACCAGTCTTTTGTGTGTAGACACA
GCATTTACAGACGATGTGTAAAATATTTTCATAGGTTCAT
CAGATGTATATATAAAAATATTTATTTGATTTTTATAAGT
ATAAAACATGTATTAGGGAAACTGTTCACAAATAAAACCT
AATTTCTGTCTTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations