Transcript

ywhag1-201

ID
ZDB-TSCRIPT-110325-2509
Name
ywhag1-201
Previous Names
  • ywhag1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050215 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050215|OTTDARG00000035302|ZDB-GENE-011115-1 ywhag1|OTTDARP00000039417 ywhag1-001 LG_none CU693475.5,CU694208.5,CU655839.5 Danio rerio protein_coding KNOWN, 1374 bp
TGAAAGCGTCCAGGAGGAGGCGCGTCCTGCATCGGCACGC
GTTCAACAGCAGAGAGCAGGGGAAAGAGAAGCGGACAGAG
GAGCTTTACAGTCGCCAAAAAAAAAAAAAAAAACCCTGAG
AGCACTCATACTGCACCCCAAAACTGAACATGGTCGACCG
CGAGCAGCTGGTGCAGAAAGCCAGACTGGCCGAGCAGGCG
GAGAGATATGATGATATGGCTGCAGCCATGAAATCGGTGA
CAGAGCTGAACGAAGCCCTGTCCAACGAGGAGAGGAACCT
GCTCTCGGTGGCCTACAAGAACGTAGTGGGAGCACGCCGT
TCCTCCTGGCGCGTCATTTCCAGCATCGAGCAGAAGACCT
CAGCGGACGGCAATGAGAAGAAAATTGAAATGGTCCGCGC
TTATCGTGAGAAGATCGAGAAGGAGCTGGAGACCGTGTGC
CAAGACGTGCTCAACCTCCTCGACAACTTCCTGATCAAGA
ACTGCGGCGAGACCCAACACGAGAGCAAAGTCTTCTACCT
GAAGATGAAAGGCGACTACTATCGTTACCTGGCGGAGGTG
GCGACAGGGGAAAAGCGAGCCGCGGTGGTGGAGTCTTCAG
AGAAATCCTACAGCGAGGCTCATGAGATCAGCAAAGAGCA
CATGCAGCCTACGCACCCCATTCGCCTGGGTCTGGCGCTC
AATTACTCCGTCTTCTACTACGAGATCCAAAACGCACCCG
AACAAGCCTGCCATCTGGCCAAGACGGCATTTGATGACGC
GATCGCCGAATTGGACACCCTGAACGAAGACTCCTACAAA
GACTCGACCCTCATCATGCAGCTCCTGCGAGACAACTTGA
CGCTCTGGACGAGCGATCAACAAGACGACGAGGGAGGCGA
AGGCAACAATTAGAGCGTTGAAGAAAAGCGAAGATCTTTC
GAGACCCTTTTCCTCTCAGCCGTAACATAAAACACGCGTG
CTCACACTACGAAGAAAAACAAACAAAAAAAATTTCACAA
AAGGGAGGCATGATGGAACTGTGTCAGCTATGTTTGCTGA
TAAGTAAAGCAGCGCAGTTTTCTTTGATTTCCACTAAATT
ATAACAGATAAAGCGAGATTAATCGAATGGTATGCCTCAA
ATCAAAATTAAGAAGTAGTTTTAAAGATTAAAATAAAATA
AACTCTCCTTCTGTGACGTTTACTTTGAGGAAAAAGTCTG
GTCAGTACGTCGGTCTGCTCAAAAAGGCTGAAAAAAGGGT
TACGATACACCCAAACACTGGCATAGTGACTGTTCTTGTA
GTGAAATACGAAGCGGAGCTGCTTATATTAATTTACATTT
GGAGTAAGGAGTACTTCGAGGGTTGGCTTAAGGTAAAAAA
AAAAAAAGAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations