Transcript

fas-201

ID
ZDB-TSCRIPT-110325-2421
Name
fas-201
Previous Names
  • fas-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049814 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049814|OTTDARG00000035055|ZDB-GENE-061019-2 fas|OTTDARP00000039082 fas-001 LG_ CU464131.5 Danio rerio protein_coding KNOWN, 984 bp
TATGACTTACTGTACAGTTCATCTGACGTTCGAGATTCGC
TTCTAATTCGGGTGACCTCCTCGAGATGTTTGTTTGCAAA
TTCGGCGTTTTTATCGTCTTTGTGATGCCCACTTTGACTT
ATAGCTGGCGCTTGAGACGCGATGCCTCCTGTGAGTTTGG
AACTTACCAGCATGAGAGGAACACATGTTGCCTCTGTCCT
GCAGGATTCAAGGTTTCTACACACTGCACAAACACAGACA
AAACAGAATGTAAGCAATGTGAGGATGGCTACTATTTAAA
CAACAACAATAATGAAAACCAATGTCGACCTTGTAAGATC
TGTGACGCTAATGCAAAAATGAAGGAGATTGAGAAATGTT
CCAAGAGTTCAAACACAGTCTGTGGGTGTGAGGAGGGTCG
CTTTTGTGACAAGGACAAAGACTGCAACGTCTGTTACCCC
TGTGATCCATGTCCAAATGGTGTGAAAGAACAATGCACAG
AAACCCACAACACAGTGTGCCATGATGCCAAAGACTTAAC
TGGAACCATTGCTGCTGTTTTGGTGCCACTCATCCTAATA
GCTGTTCTAGCTTTTATGATTTTTATATGGAAAAAAAAGA
AGTTTTGCTTTCAGGTCCGCCCGAGTACAGATAAAGTGCA
GACTGAGGAAGCACTTCCTCTGATTGATTTAAGCCCTCAC
CTCCCAAAAATTGCTGATGTTCTATGCTGGAAAACAGTGA
AAGAAGTTGCGCGCCGCAGTGGCATGACTGCAAAAGATAT
TGAGGAACAGGAGATGAACCACCCAAAAGACGTGAGAGAA
CAGACTTTTGGGCTTCTGGAGGCTTGGTCCCAGAGACAGG
GATTAGATAAAGCCTACAGAGCTCTCATCACCACTCTGCA
GGACATCGGGGAAAAAGCAACAGCAGATAAAATCCGGAAC
ATTGTCGAGGCTTCATCTCAGCCATAAACTGCAGTCCAGA
AGCACAGTGTTAAAAATGAAGCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations