Community Action Needed: Please respond to the NIH RFI
Transcript

sox3-201

ID
ZDB-TSCRIPT-110325-2367
Name
sox3-201
Previous Names
  • sox3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049557 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049557|OTTDARG00000034904|ZDB-GENE-980526-333 sox3|OTTDARP00000038877 sox3-001 LG_ BX088596.9 Danio rerio protein_coding KNOWN, 1764 bp
AGCTTAGCGCACAACTTTGCAGAGTTCCGTGGCAGAGCAG
AACGAGACACACGGCACTGTTGTGGAGACTTTTGAAAGAC
TTTACTTGACCAGAGTTTGAGCTCTCTGAACTTTTGACTG
ACTTCATTTTTTTGTGAGACTCTTGAAATTTCAACGTTTT
CTTTCGAGTGCTTGGCACCACTTTTAAGAATGTATAACAT
GATGGAAACCGAGATTAAAAGCCCCATTCCGCAGTCCAAC
ACGGGCTCGGTGACGGGCGGCAAAAACAACAGTGCCAACG
ACCAGGACCGGGTGAAGCGGCCTATGAATGCTTTCATGGT
GTGGTCTCGCGGGCAGCGGAGGAAGATGGCTCAGGAGAAT
CCTAAAATGCACAACTCGGAGATCAGCAAGCGCCTCGGTG
CTGACTGGAAACTTTTGACTGACGCCGAGAAGAGACCCTT
CATTGACGAGGCCAAGCGGTTACGAGCCATGCACATGAAG
GAGCACCCGGATTACAAATACCGTCCCCGCAGGAAGACCA
AGACCCTGCTGAAGAAAGACAAGTATTCTTTGCCAGGGGG
ACTCCTGGCGCCCGGTGCCAACGCTGTCAACAACGCGGTG
TCGGTGGGCCAGCGGATGGACTACACGCACATGAACGGAT
GGACGAACAGCGCATACTCCCTCATGCAGGACCAGCTGGC
CTACCCTCAACATCCCAGCATGAACAGCCCCCAGATCCAG
CAGATGCACCGGTACGACATGGCGGGACTTCAGTACCCAA
TGATGTCCACGGCTCAGACCTACATGAACGCCGCGTCCAC
GTACAGCAGCATGTCACCAGCATACACGCAACAAACTTCC
AGTGCAATGGGTTTGGGCTCCATGGCTTCGGTGTGCAAGA
CGGAGCCCAGCTCCCCTCCTCCGGCCATAACCTCTCACTC
TCAGCGTGCTTGTTTGGGAGACCTGAGAGATATGATAAGC
ATGTACCTGCCGCCCGGTGGAGACAGCGCCGACCACTCCA
GTCTACAGACCAGTCGGTTACACAGCGTTCATCCGCACTA
TCAAAGCGCAGGGACAGGCGTGAACGGAACGCTACCCCTA
ACCCACATTTGAAAGACTCCTTGAAAAAAAGACTAAGTAC
TTCGGATACTTGAACATTTTGATTTGCAAAAAAGAATCGA
AGTTCAGTTTCGTTTTTAAAAAAAGAAACTATTTTTAATC
TCAATGAGTTGTCCGTTTTAAAGCATTTTATGACGACATA
TCGGGGACTTCAGATTAAATTGTATTGCAGAGGAGCTTTT
TATTCATAAGCTGTAAAGCAATCAACGTCTGTAGAAGAAT
ATTGGACTTCTGACTTATTTGCTGTCAAGAGTTTGTCTCT
CGGCACGTGGCTTCGTGAAGAGGCTCTATTTCAAAAACAA
AAAAGAGAAACGGAGGGAGAGTACGTTCACTCATAAATGT
TTACACTTATTTTTAGAATGTCGATTATGTCCAAATCTGT
GTAGTCCTTTTGTTGTTCATTTATGAACTTGGTTTTATGA
AATGAAAGACTGTGCTGGTCGCAAGCGCAAAGTTTGTTTT
ATTTATAGTGAGTTGTTTTTTTAAAGCTTGTGAACCATTG
TACGTCTTGTTGAATTGTTCCACTTTTGTTTGTGAATATT
CTTTTCTGTGATGTTATGGCAGTATCAGGTTAACCCATTA
TCTGGGACGGAGAGTTTTATTTAAACTGACGTTTCTACTT
AAGACCATCCTATTCCTAAATGAATAAATTTGTTTTACAA
AAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations