Transcript

hdc-003

ID
ZDB-TSCRIPT-110325-2226
Name
hdc-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049105 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049105|OTTDARG00000034666|ZDB-GENE-080102-5 hdc|no_translation hdc-003 LG_ CU611046.7 Danio rerio protein_coding KNOWN, 351 bp
ACTGGTGTGTGTTCCTTCGACCGTCTGGATGAACTGGGCC
CCGTCTGTGTGCGCGAGGGCCTCTGGCTGCATGTGGACGC
TGCGTACGCTGGCTCTGCGCTCCTCTGTCCTGAGCTGCGC
TATTTCCTGGACGGAATCCAGTTTGCAGATTCGTTCGTCT
TCAACCCGTCCAAGTGGATGCTGGTGCACTTCGACTGCAC
CGCCTTCTGGGTGAAGAATAAGATGAAGCTCCAGCAGACG
TTCACTGTGGACCCGCTGTACCTCAGACACGATAACTCCA
ACGCCACAGACTTCATGGTGCGCTCTCATCACACACTGCA
TCATCTGTGTGTGTGTGTGTGTGTGTGTGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations