header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2159
Transcript Name: ubox5-201
Previous Names: ubox5-001, ch73-368o6.1-001, si:ch73-368o6.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048890 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048890|OTTDARG00000034539|ZDB-GENE-110411-166 ubox5|OTTDARP00000038366 CH73-368O6.1-001 LG_ CU469500.10 Danio rerio protein_coding NOVEL, 1602 bp
CCCGCCAGCAGGTGCCAGGAGTGAGCGGCGCGCGCGCATT
TCCTCACGGAAGTAGCGGTGACGTGATCGCGCTGCTGTGT
CTCTGCTGTGGCGCTGTGAAAGCGGAGGCCATGGTGTTCA
ATCTCTGCCTGCCACACTTTCAGACCTCCATTCACTGCAA
CAAGCTGTGTGCCGATGGCTACGACGTGTCCAACCTTCTC
TCCGAGGATCTGAATGTTCGCCGGAGAGGATTTAAGCTGG
AGTACTTCCTGCGGCCGCCCGTGCATGTCACACTGAACTT
CCAGGTGCAAATGGAGGTGTGTCGGCTGGACGTGGAGCTG
TGGCCGTGGGGAATGGATCAGGGCCGGAGCTCCCGGAGGA
TTGAGATCCTCACAAGTTCAGAAAAAAGCGGCGAGAACTT
CCAGCTGGTGTCTCGATGTGATCTGAAAGAAGAGATTCAT
CTTTCTTTCACGCATCCCTTCTTTAAATCTCGTCCTCCAT
TCTGTGATCCTCCTCCGCCTTTTGTTGGCGAATCTAAAGA
GTTTTGGAGCCCCAGATCTCTATCATCCGTCGCTCAACTA
CGCATCAGTATTCCCTACAGCGGAGCTGCGTCTGCGCTCG
GATTTCGCTCTCTTTCCATCTGGGCTTTGCCTTCTCGATG
CTGTAGTGAATCTGAACTCAAAAAAATCCATCAAGCACAT
CTAAACACGCTCAAAATAAACCCAACAACCCCGATTGCCA
CTAAATCAGAATCATTTCAGACTGATTCTCCAACTCCAGA
AGAGTTCCTAGATCCATTGACGCAGGAACTAATGGTTCTC
CCTATGATTTTACCCAGTGGCATGATAATCGATCAGAGTA
CTTTGGAGGAGTACGAGAAAAGAGAGGCGACATGGGGTCG
ACTGCCGAATGACCCGTTTACCGGCGTTCCCTTCACACCG
AGCTCCAAACCTCTCCCGAACCCGCTATTGAAGAGCCGCA
TTGACCGTCTGCTCCTGCAAACGGGACACACAGCCGTCGG
GAGCAGGAATAATACACTAAATAAACCACAGCCGTCCAGA
CTGATGTCTCACAGTGTCACAGACTCCAATGAAACACACA
GAATGCAGTCTGAACGTGTTTTAGAGACACAGAGACAGAG
ATGTTCGGCTAAAAGAAAGCGGGAGTTCAGCTCTCCATCC
ACCAGCGCTGATGCTGATCACCCTCCATTGAGGAAAACAC
TCCACACGCACACAGAGTCGGATTCTCATGAGCGGAGGTT
AGCAGACAGTTTAGATCAAGCTCTGAACGCTGCACTTGAT
GGCTTACCAGTGTTCACTACACAGAGCAGAAGCACTGCAG
ACATTGAGAACACCTCCACTGGTGGACAGACGTGTGTTTT
CTGCTCGTGTTCACTGACGGTTTATTCCTCCAGCGTGCCA
TCATATTCTCTGCCCTGTGATCATCTCCTGTGCGGCCCGT
GTTTGAGACACAGAAACACGTCTGATCCACAGAAAACAAC
GATTAACTGTCCGGCATGCGGATCATCAGCTTCATCCAGA
GACATTACACGAGTTCATCACTGAATCTGCCTGTGTGCTT
ATTTTTGTGTGTGTTGTATTCATTAAACAAAATTGAGAAG
CA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ubox5-201 Contained in:
[BAC] CH73-368O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000048890 (1),  Ensembl_Trans:ENSDART00000081445 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC055603 (1) 1589 bp
GenBank:BM181889 (1) 630 bp
CITATIONS (2)