Transcript

ottdart00000048848

ID
ZDB-TSCRIPT-110325-2145
Name
ottdart00000048848
Previous Names
  • dkey-32e23.7-001
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048848 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048848|OTTDARG00000034518|ZDB-GENE-040704-16 zgc:91909|no_translation DKEY-32E23.7-001 LG_ CR855300.21 Danio rerio processed_transcript PUTATIVE, 637 bp
TGTAATCTGTATGCAATGTACAGTATAAGTCCTGCAAATC
TCAATGACGGAGATTTTTGTAACTTGTAAACAAGGAGGCC
GCTGTCATTTTTGGAGATTTGCCATCAATAATAAGCTGGG
AATTACTTCAGAAGACCAAAACAATCAGACAAGACATTAT
TTTGAGGATGATATTGCTTAAGATGTAAACAGAAACTGAC
ATTAAAGGAGGTTGGTGTCATGATCTTGTTTCCTTTGAGT
GCGCATTAGATAAAAACAAGCAGACTTTGTGTGTTTTGAA
CACTATTTGAGACAGTTGTTTAATTTTATTCATGATTCCA
AATATGAACGTAAGCTTGGCAAACAGCTTTGGAGAATTTG
ATGTTTCCCCAGTCAAACAGAACTGCTCAACAAGCGTTTC
AAAGATGGCCGCCGAGTGAAATTACTTGCCTTAAAGGAAT
TTTAGTACGGTTAAGGTTAGGGTTGGGGGGAGGCCACTCT
TCAATAATGTTACTTTCTTTATACTAATAAATTCATACAA
ACTAGTCCCTCGGCAAACAGCTTTGGAGAATTTGAAGTTT
CCTCATTCAAACAGACTTGCCCAGGAGGCGTTTCAAAGAT
GGCCGCCGAGTAAAATTACTTGCCTTAGATGAATTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations