Transcript

zgc:91909-201

ID
ZDB-TSCRIPT-090929-16665
Name
zgc:91909-201
Previous Names
  • zgc:91909-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036132 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036132|OTTDARG00000027015|ZDB-GENE-040704-16 zgc:91909|OTTDARP00000028993 DKEY-32E23.3-001 LG_ CR855300.21 Danio rerio protein_coding KNOWN, 1260 bp
TGCGTCAGTCCCTTGTGACTCCAGTCATGTCCTGTTCTGC
CAGGAGGAAACACATACTGCTCTTCAACAGCTGATGTGCA
TCTGGAGCAGCAGAACATTGGTGGTTTTGTGTTGAACCGC
TTTTGAGAAGATTCGGACAGCTGCGACGGTAAACGCGAAG
AGTTGAAGCAGTGTCCTTCCACACAACATGGCTTCCCGTA
AAAAGGTCCTCCTCAAAGTGATCATCCTAGGGGATTCTGG
AGTTGGGAAGACCTCTTTGATGAACCAGTATGTGAATAAT
AAGTTCAGTAATCAGTATAAGGCCACCATTGGTGCAGACT
TTCTGACAAAGGAGGTGATGGTGGACGACAGACTGGTGAC
CATGCAGATTTGGGACACAGCCGGTCAGGAGCGGTTTCAG
TCTCTGGGCGTGGCCTTCTACAGAGGGGCGGACTGTTGTG
TGCTGGTGTACGATGTCACGGCGCCCACCACGTTTAAGAC
TCTGGACAGCTGGAGGGACGAGTTTCTCATTCAGGCCAGT
ACAAGCGACCCGGAGAACTTCCCCTTTGTTGTGCTGGGCA
ACAAAATCGACCTGGACAACCGACAGGTATCGACAAAGCG
AGCACAAGCGTGGTGTCAGAGTAAGAACAACATCCCCTAT
TTTGAGACCAGCGCCAAAGAAGCCATTAATGTGGAACAGG
CCTTCCAGACCATCGCTCGCAATGCGCTTAAACAGGAGTC
GGTGGACAAATATGATTTCCCGGACGAGATCAAACTAGGA
AACGACAGACCCATGTCTAACGGTGAAGGCTGCAGCTGCT
GAAGGAAAACAATGAAGCTGTGGAGGGACGAGAAACAGCC
AACATGAGAAAGGGAAAGATCCAGGCCAGTCTTTCCTAAA
GCCCCCTTTAACTCCTTTGAAAACTGCAGGGTATCAAATG
CCACGTGTGACTATTGAACATCTATTTTCTTGCTGAACTC
CAAGTTACGTGGAAGAAGTATGGAGGAGCAGGAAGAGCTG
TATATCCTCTGACAAGTTCTACTATCACTACAGCTGCCCA
AGTATTTGTGTCACTACTCCTGCTGTCAGATTGCGTTTAT
TTTCTCTGAAAATCCAGCCTGATCTCATAAAGAAACGTAA
CTATTTTATGTACTGTCAGACAAGTGGCTAATTCTACTAA
GATTACTTTAAGGCAAGCAATTTTACTCAGCGGCCATCTT
TGAAATGCCTCTTAAGCAGTTCTGTTTGAATGTGGAAACA
TTAAATTCTCCAAAACTGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations