Transcript

mak16-003

ID
ZDB-TSCRIPT-110325-2143
Name
mak16-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048841 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048841|OTTDARG00000034513|ZDB-GENE-020419-35 mak16|no_translation mak16-003 LG_ CU695141.7 Danio rerio protein_coding KNOWN, 448 bp
TCATGTGGTGTTAATATGGCTGCCATCTGTAACTTCCATG
TGCTGTTTTATTATATCACAAAATAACTGCTCTCATCATT
TTTCTTATCCGTAAAGTTAATTTCATTGTATTGGATTAAC
ACTGACATTTACGTACAGAGAGCCGGTTGTTCAAAGAAGC
CGTCAGAATGCAACACGACGACGTTATATGGGACCTTATC
GGCAATAAGAGTTTTTGTTCCTATAAAGTTAAAACGAAAA
CTCAGCAGTTCTGCCGAAATGAATACAACATCACAGGCCT
TTGCAACAGATCATCATGCCCTCTTGCTAATAGCCAGTAT
GCAACTATAAGAGAAGAAAAAGGTAATGAATTCTGTAAAA
ATTCTACCTATTTCTTGAATGTCTATTTGATATTACAAGT
CTTCTGTTTTGTCAGGCCAGTGTTTTCTCTACATGAAAGT
TATTGAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations