Transcript

mak16-202

ID
ZDB-TSCRIPT-110325-1235
Name
mak16-202
Previous Names
  • mak16-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048840 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048840|OTTDARG00000034513|ZDB-GENE-020419-35 mak16|OTTDARP00000038329 mak16-002 LG_ CU695141.7 Danio rerio protein_coding KNOWN, 866 bp
ATTATGTGGCGCACCTGATAATTTGTTTTCACGTGTCAAC
AGTTATTTCTACCGCCGAACCTGAACAAAGAGAGCCGGTT
GTTCAAAGAAGCCGTCAGAATGCAACACGACGACGTTATA
TGGGACCTTATCGGCAATAAGAGTTTTTGTTCCTATAAAG
TTAAAACGAAAACTCAGCAGTTCTGCCGAAATGAATACAA
CATCACAGGCCTTTGCAACAGATCATCATGCCCTCTTGCT
AATAGCCAGTATGCAACTATAAGAGAAGAAAAAGGCCAGT
GTTTTCTCTACATGAAAGTTATTGAGAGAGCAGCATTTCC
TTCTCGCATGTGGGAGAAGGTGAAACTTGACAGAAACTAT
GCAAAGGCTCTGGAACAGATCGACGAGAACCTCATCTACT
GGCCACGGTTTATCCGTCACAAGTGTAAACAGCGATTGAC
CAAGATCACCCAGTATCTCATTCGAATCCGCAAGCTCACG
CTAAAACGACAGAGAAAACTGGTTCCACTCAGTAGAAAAG
TAGAGAGACGAGAAAAGAGGAGAGAGGAAAAAGCTCTTAT
TGCCGCTCAGCTGGAAAATGCCATCGAAAAAGAGCTGCTA
GATCGGCTAAAACAGGGAACATATGGAGACATTTACAACT
TCCCCATCAATGCCTTCGACAAAGCTATGGAAAAACAGGA
TGAAGAAAGTGAATCTGAGGAGGAGGAGGAGGAAGAAGAG
GAAGACGAAGAGGAGTCTGGAACGAGAGAATTTATTGCTG
AGGATGAGTTTGAAGAGAGTGATCTCAGTGATTTTGAGGA
ATTGAACAACCTGAAGGACAGCAGTGACGAAGAAGTGAAC
AATGAAGAGGAATCCAGTGAGGAGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations