Transcript

lck-202

ID
ZDB-TSCRIPT-110325-1990
Name
lck-202
Previous Names
  • lck-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048105 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048105|OTTDARG00000034081|ZDB-GENE-040617-1 lck|OTTDARP00000037747 lck-002 LG_ CR392364.6 Danio rerio protein_coding KNOWN, 1994 bp
AATCAAGTGCTTCTTTTAAGAAAGATAACGGTTATGGGAC
ATGGCAACGCCTGCTGAAGTGGCCCAGCATTGATATCCGT
GTCTTCTGTCGACAAAAATACGTAAACATGGGGAACTGCG
GCTCTTTTGATCCTGATGATGAATTCTCCTACCATCCAGA
TGAATGGTGTGACCAGTGTAACTGCCCCAAGCCTCCAGTC
AGTCAGAATTTTGATCCTCTGATTCCATATCCATCTCAGT
ATACACCTCCACCATCATCTCCTCTTCCAGAGAACCTGGT
GGTGGCCATATACAAATATGATCCAGCCCACAGTGACGAC
CTGGGGTTTGAGAAAGGGGAGAAGATGAAAATCCTAGACT
GTGATGATCCTGAATGGTACATGGCGGAGTCTCTGTTCAC
CGGCCAGAGGGGTTACATACCAAAGAACTTTGTAGCAAAA
CTGAACAGCATGGAGACAGAACCGTGGTTCTATAAAAATC
TCTCCAGGAATGACGCCATGAGGCAGTTACTGGCTCCTGG
CAACACACAGGGCTCGTTTCTCATCAGAGAGAGCGAGACG
CAGCCAGGTAGTTTCTCCATCTCTGTGAGAGACCTGGACC
CAATGCAGGGGGACATCATCAAGCACTACAGGATCCGCAA
CATGGACGCAGGTGGATTCTACATCACCAACAAGATCTCC
TTCAACTCCCTATCAGAGCTTGTCAAACATTATTCACGAG
AAGCTGATGGACTGTGCACTCGGCTGGTGAAACCGTGTCA
GACCAGAGCGCCCCAAAAACCCTGGTGGCAGGATGAGTGG
GAAGTGCCTCGCGAGTCTCTCAAACTAGAGCGCAGACTGG
GGCAGGGGCAGTTTGGAGAAGTATGGATGGGGCTATATAA
CAACAACCGTCAAGTGGCTATCAAGAGTCTGAAGCCTGGT
ACCATGTCCATCAGCGCTTTCCTAGCTGAGGCAAACCTTA
TGAAGTCCCTACAGCACCCTCGACTGGTGCGACTGTTCGC
TGTGGTCACGCAGGAGCCCATTTACATCATCACCGAGTAC
ATGGAGAACGGCAGCTTGGTGGATTTTTTGAAAACTCCCG
AAGGAAGTGATATACCCATCAATACGCTCATCGACATGGC
TGCTCAGGTTGCAGAAGGAATGGCTTACGTAGAGCAGAAG
AACTACATCCACAGAGACCTGAGAGCTGCCAATATTTTGG
TGTCTCATGAACTCACATGCAAGATTGCTGACTTCGGCCT
GGCCCGTCTCATTGAAAACAATGAATACACCGCCAGAGAA
GGTGCGAAGTTTCCTATCAAATGGACGGCACCAGAGGCCA
TAAACTACGGCACATTCTCAATCAAATCAGACGTCTGGTC
ATTTGGTGTACTGCTGACAGAGATCGTTACTTATGGAAGG
ATCCCATATCCAGGAATGACAAACCCAGAGGTGATCGCAA
ACCTCGAGAGGGGCTACCGCATGCCTTGCCCCGATAACTG
TCCTGAGGCTCTCTATAACGTTATGAAACACTGCTGGACG
GAGAACCCAGACAACCGGCCCACCTTCGAGTTCCTGCGCA
GCGTTCTAGAGGACTTTTTCACTGCTACAGAGGGACAGTA
CCAGGAGCAGCCCTGCTGAACAGAGTAAACTGAAAATCCA
TGGGCTCACATTAAAGACTTTTGTTGCATTGAGAAATATT
TGAAAATATTTTTAGTCAAAGCAAAAAAACTGAGATTATA
AGCCTTATCCAATTTTATCTTGATGTTTAAAACTGATTTT
GTCCTATCTTATTTTGTGTGCATGTATATTTTTAGCAGAT
AAAAAAGGTTTTTACAATTTTTTAAATAACAAGCCAAACG
GGAAAAGTTCAGCTTCACATAATCTGGTCTGGTTGAATGC
TCTGCCTTTTTACATTGAGTTTTTATCATTTCTGCTGTAA
GAGCTGTCTTTTTATTTTTACAGAAGTAAACTGCATCATT
TTTTTTAATAGTAAAACTATCGAAGAGATAAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations