Transcript

lck-201

ID
ZDB-TSCRIPT-110325-175
Name
lck-201
Previous Names
  • lck-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048106 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048106|OTTDARG00000034081|ZDB-GENE-040617-1 lck|OTTDARP00000037748 lck-001 LG_ CR392364.6 Danio rerio protein_coding KNOWN, 2107 bp
CTTCTTTTAAGGTGGGAAGTAAAACTGTGATGTGACGTAC
ACATTTTTACAATTTGGCAGCACATGTCTTTGAAACACGC
CGAAGAAGATCTCGATGGTTTGTCTGTAATTTGAGGTGTA
ATGTGTTCTTGGTAGAAAGATAACGGTTATGGGACATGGC
AACGCCTGCTGAAGTGGCCCAGCATTGATATCCGTGTCTT
CTGTCGACAAAAATACGTAAACATGGGGAACTGCGGCTCT
TTTGATCCTGATGATGAATTCTCCTACCATCCAGATGAAT
GGTGTGACCAGTGTAACTGCCCCAAGCCTCCAGTCAGTCA
GAATTTTGATCCTCTGATTCCATATCCATCTCAGTATACA
CCTCCACCATCATCTCCTCTTCCAGAGAACCTGGTGGTGG
CCATATACAAATATGATCCAGCCCACAGTGACGACCTGGG
GTTTGAGAAAGGGGAGAAGATGAAAATCCTAGACTGTGAT
GATCCTGAATGGTACATGGCGGAGTCTCTGTTCACCGGCC
AGAGGGGTTACATACCAAAGAACTTTGTAGCAAAACTGAA
CAGCATGGAGACAGAACCGTGGTTCTATAAAAATCTCTCC
AGGAATGACGCCATGAGGCAGTTACTGGCTCCTGGCAACA
CACAGGGCTCGTTTCTCATCAGAGAGAGCGAGACGCAGCC
AGGTAGTTTCTCCATCTCTGTGAGAGACCTGGACCCAATG
CAGGGGGACATCATCAAGCACTACAGGATCCGCAACATGG
ACGCAGGTGGATTCTACATCACCAACAAGATCTCCTTCAA
CTCCCTATCAGAGCTTGTCAAACATTATTCACGAGAAGCT
GATGGACTGTGCACTCGGCTGGTGAAACCGTGTCAGACCA
GAGCGCCCCAAAAACCCTGGTGGCAGGATGAGTGGGAAGT
GCCTCGCGAGTCTCTCAAACTAGAGCGCAGACTGGGGCAG
GGGCAGTTTGGAGAAGTATGGATGGGGCTATATAACAACA
ACCGTCAAGTGGCTATCAAGAGTCTGAAGCCTGGTACCAT
GTCCATCAGCGCTTTCCTAGCTGAGGCAAACCTTATGAAG
TCCCTACAGCACCCTCGACTGGTGCGACTGTTCGCTGTGG
TCACGCAGGAGCCCATTTACATCATCACCGAGTACATGGA
GAACGGCAGCTTGGTGGATTTTTTGAAAACTCCCGAAGGA
AGTGATATACCCATCAATACGCTCATCGACATGGCTGCTC
AGGTTGCAGAAGGAATGGCTTACGTAGAGCAGAAGAACTA
CATCCACAGAGACCTGAGAGCTGCCAATATTTTGGTGTCT
CATGAACTCACATGCAAGATTGCTGACTTCGGCCTGGCCC
GTCTCATTGAAAACAATGAATACACCGCCAGAGAAGGTGC
GAAGTTTCCTATCAAATGGACGGCACCAGAGGCCATAAAC
TACGGCACATTCTCAATCAAATCAGACGTCTGGTCATTTG
GTGTACTGCTGACAGAGATCGTTACTTATGGAAGGATCCC
ATATCCAGGAATGACAAACCCAGAGGTGATCGCAAACCTC
GAGAGGGGCTACCGCATGCCTTGCCCCGATAACTGTCCTG
AGGCTCTCTATAACGTTATGAAACACTGCTGGACGGAGAA
CCCAGACAACCGGCCCACCTTCGAGTTCCTGCGCAGCGTT
CTAGAGGACTTTTTCACTGCTACAGAGGGACAGTACCAGG
AGCAGCCCTGCTGAACAGAGTAAACTGAAAATCCATGGGC
TCACATTAAAGACTTTTGTTGCATTGAGAAATATTTGAAA
ATATTTTTAGTCAAAGCAAAAAAACTGAGATTATAAGCCT
TATCCAATTTTATCTTGATGTTTAAAACTGATTTTGTCCT
ATCTTATTTTGTGTGCATGTATATTTTTAGCAGATAAAAA
AGGTTTTTACAATTTTTTAAATAACAAGCCAAACGGGAAA
AGTTCAGCTTCACATAATCTGGTCTGGTTGAATGCTCTGC
CTTTTTACATTGAGTTTTTATCATTTCTGCTGTAAGAGCT
GTCTTTTTATTTTTACAGAAGTAAACTGCATCATTTTTTT
TAATAGTAAAACTATCGAAGAGATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations