ZFIN ID: ZDB-TSCRIPT-110325-1938
Transcript Name: epha4a-203
Previous Name: epha4a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047946 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047946|OTTDARG00000033995|ZDB-GENE-001207-7 epha4a|OTTDARP00000037627 epha4a-001 LG_none CU929371.4,FP236331.9 Danio rerio protein_coding KNOWN, 3806 bp
AAACGCTAATTCCACCGGGACAGACGCAACTTCGGTCCGC
GCGCGGAGCGGAGGAGACGCACACGAAATGACACCAATGG
CTGCGCTTGTGTTCACAGCGACTTTTGCGCTAATAATCTG
GATACCGACTTTCGCATTAACCGCACGGGTCTACCCTCCT
AATGAAGTGACACTGCTGGACTCGAGAACTGTGCAAGGAG
AATTGAAATGGGTTGCAAGCCCGACGGAAGGAGGGTGGGA
AGAGGTGAGCATCATGGATGAGAAGAATACGCCAATCAGG
ACGTACCAGGTGTGCAACGTAATGGAACCCAGCCAGAACA
ACTGGCTCCGAACGGACTGGATCCCCCGTGGCGGAGCTCA
GCGGGTCTACATCGAGATCAAATTCACCCTGCGTGACTGC
AACAGCCTGCCAGGAGTCATGGGAACCTGCAAGGAGACCT
TTAATCTTTACTATTATGAGTCCAACAATGACAAAGAGCG
ATACATCCGAGAAAACCAGTTCACCAAAATCGACACCATT
GCGGCTGATGAAAGCTTCACGCAGGTGGACATAGGAGACC
GCATCATGAAGCTGAACACGGAGGTGAGGGATGTGGGGAT
TTTGACAAGGAAGGGCTTCTACCTGGCCTTCCAGGACGTT
GGGGCTTGCATTGCCTTGGTATCAGTACGGATCTTCTACA
AGAAATGCCCGCTTACTGTACGCAACCTGGCCCAATTTCC
AGACACCACCACCGGCGCAGACACCTCATCGCTAGTGGAG
GTACGCGGATCCTGTGTGGACAATTCGGAGGAACGTGAGG
TCCCTAAAATGTACTGCGGAGCAGATGGAGAATGGCTGGT
GCCTATTGGAAACTGTTTGTGTAACCCTGGCTATGAAGAA
CATGAAGGGACATGTCAAGCCTGTAAGATCGGCAACTACA
GAGCTCTAGCCACAGACGGCAGCTGCTCTAAGTGTCCCCT
GCACAGCTACTCTGTGAGAGAGGGATCTACTTCCTGTGCC
TGTGATAAAGGCTTCTTCAGGTCTGAGACGGACCCTGCAT
CTATGCCCTGCACACAGCCCCCATCTGCTCCTCAGCACCT
CATTTCCAATGTGAACGAGACTTCGGTGAATCTGGAGTGG
ACGGCTCCAGCATCCTCTGGTGGCAGACAGGACCTTGCCT
ATAACGTTATATGCAAGCGGTGCAGCTCGGACGGTCAACG
CTGTCAGCCCTGTGGCAATGGCATCCATTTTTCCCCTCAG
CAGCTGGGCCTACGCACTACCCGGGTGTCCATAAATGACC
TGCAGGCTCACACCAACTACACCTTCGAGATCTGGGCAGT
CAACGGGGTCTCCAAACAGAGTCCTGGACCCGAACAAGCA
GTCTCTGTGACTGTTACCACCAACCAAGCGGCTCCCTCTC
CAGTTACCACCATCCAGGCCAAGGACATCACAAGACATGC
TGTGTCTTTGGCATGGCAACAGCCCGAGAGACCCAATGGA
GTCATTCTTGAGTACGAGGTCAAATACTATGAGAAGGATC
AAAACGAGCGCAGTTATCGCATAATGAAGACTTCGTCCCG
AAGCGCTGAGATCAAAGGCCTGAGCCCACTCACCTCCTAC
GTGTTTCATGTGCGTGCCCGCACCGCTGCTGGCTACGGAG
AATTCAGTGCCCCTTTTGAGTTCATGACCAACTCAGTTCC
TTCTCCCATCATCGGGGACGGAGCTAACTCCACCGTGCTC
TTGGTGTCTGTGATCGGCAGTGTGATTTTGTTGCTCATCT
TCATCGGCGTCTTCATCATCAGCCGCAGGAGAAGCAAATA
CAGCAAAGCCAAGCAGGATTCTGATGAGGAGAGGCATTTA
CACCCAGGAGTCCGGATCTATGTGGACCCCTTCACATACG
AGGACCCCAACCAAGCAGTCCGTGAATTCGCTAAAGAAAT
CGACGCCTCCTGCATCAAGATCGAAAAGGTCATCGGCATT
GGAGAATTCGGAGAGGTGTGCAGTGGCCGTCTCAAGATGC
CTGGAAAGCGTGAGATCTGTGTGGCCATAAAAACCCTAAA
GGCAGGATACACCGACAAGCAAAGGCGGGATTTTCTGAGC
GAGGCCAGCATCATGGGCCAGTTTGACCACCCTAACATCA
TCCGATTGGAGGGAGTTGTCACTAAATGTAAGCCAGTTAT
GATCATCACAGAGTACATGGAGAACGGATCACTGGATGCT
TTTCTTAGGAAGAATGATGGACGGTTTACAGTGATTCAGC
TGGTGGGCATCCTGCGAGGCATTGCTTCAGGAATGAAATA
TCTCTCCGATATGAGCTATGTCCATCGTGACTTGGCGGCT
CGCAACATTCTGGTCAACAGCAACCTGGTGTGCAAAGTGT
CCGACTTTGGCATGTCTCGAGTTTTGGAGGAAGACCCAGA
TGCTGCTTATACCACCAGAGAAATAACAGGAACCTATCAA
TCACAGGGAGGCAAGATACCCATTCGCTGGACGGCTCCTG
AAGCCATTACTTACAGGAAGTTCACCTCTGCATCTGACGT
CTGGAGCTATGGCATCGTCATGTGGGAAGTGATGTCATAT
GGAGAGCGGCCATATTGGGACATGAGCAACCAGGATGTGA
TAAAGGCCATTGAGGAAGGCTACAGGCTGCCTCCTCCCAT
GGACTGTCCAGTTTCTTTGCACCAGTTGATGTTGGATTGC
TGGCAGAAAGAGCGCGCAGAAAGGCCAAAGTTCAGTCAAA
TTGTCAACATGCTGGACAAACTCATCCGCAACCCTAACAG
CCTGAAAAGGACAGGAGGAGAAATAGCCAGACCCAACACC
ACCCTCCTGGAGCCTAGCAGCCCAGAATTCACGTCTACCC
TGGGATCAGTTGCCGACTGGCTGCAGGCCATCAACATGGA
ACGTTACAGAGACAACTTCACCGCTGCTGGCTATACCACT
CCAGAAGCTGTGGTCCATATGACACAAGAGGACATGACGA
GGATAGGGATCTCCACCGCTGCACACCAGGATAAGATCCT
CAACAGCGCGCAGGGAATGTTGTCCCAGATGCAGCAAATG
CAGGACAGGATGGTTCCTGTCTGAACCCCACGGGATCAGA
AAACACATTCACACACACTTTGGACTTCCTTTTTTTATTT
TGGTTCTAAGAAAATCCATTTACCTCATCCATGCACTTTA
AATTCAATTTTTTTGTGGGGGAAAAAAGGAAAATATTTCA
AAGGAACGATACAGCACTTTTCTTTTAATAACGCCATCGA
GTCAAGAGGATCGTTTAGCGCTGTACTGACGCTCTGGATG
GGATTGTAGGAAGCTTTTCATTTCACCGAAACTACGAAGG
AGTTTGTTTATTTGATTTTTTATATGTATGTGCCTGTAAG
TAAATGTATAAATAGTACTGGATTTTTACTTTTTTTTTCC
GTCCGCTCTTGCCATTTCACGGTTGCTTGAGTGAGCGGCA
CCTGGTGGAATTTTTACGCTCGAATTTGAGGCGACGGAGA
TAAAGATTTTATGCACTCTTAACGCTTTTGTTCCGGGGAT
TTCGGAGAGGCATTCATCTTCCCAGCAGCCACAATGGAAG
ACCACTTCTGGAAGGTCTCCAGGTCTCTCCACCCTCAGAA
TGGAATATCTGTCTCCACTTCGCAATTCGCTCCACTCGGC
CTGGCCTGGAATAGAAAAATGGGCCCTCAGTTTACATCTT
TCTCTCTCCACCTCAGTCTCTACGGTTTTCCCTCTCTCTC
TCTCTCTGTGTCTCCGGAGACCTTCGGCAGGCCGTGAAAT
CAACACATGTCTCCCTTACTGGAAGTTCCATCAGAGCTGA
ACTAAG

epha4a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA epha4a-202 (1)    Ensembl 985
epha4a-203 3387
ncRNA epha4a-003 (1) 1693
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
epha4a-203 Contained in:
[BAC] CH73-275D12 (1), CH73-362D4 (1)

Genome Resources: Vega_Trans:OTTDART00000047946 (1),  Ensembl_Trans:ENSDART00000149895 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT607583 (1) 894 nt
GenBank:DT058013 (1) 775 nt
GenBank:CT686244 (1) 724 nt
GenBank:AW175051 (1) 569 nt
CITATIONS (2)