Transcript

klf11b-002

ID
ZDB-TSCRIPT-110325-1850
Name
klf11b-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039388 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039388|OTTDARG00000028793|ZDB-GENE-061103-82 klf11b|no_translation klf11b-002 LG_none BX927337.10,CR627496.8 Danio rerio protein_coding KNOWN, 950 bp
ATACTGCTTCTGGATCCATGAATAGATAAAGACAGAGAAA
GACTCATTCAGATCCACCCAGCAGCTGAGCTGTATGTCTC
ACAACAACCAGAAGACTTCCTTTCACCCTTAATAAAAAAC
GTTACTTGATTATTTTTTTTATTTTTTGTGGTTCTCAGGG
AGCTCGGATGGAGGTCTGTGAAGATTTTTTAGACGTGAAG
AAGAACAGTGAATACTCTTCATGCAGTGCTCTGGAATACA
ATGATCTTGAGGCTGCTGAAGCCCTGGTTTACATGAGCTT
CTGGAGTCAGATGTCTCCAAAACCCAACGTCTTCAAACCT
CGTCCTCTCACGCCAGCGTCAGACTCCTGTGATTCCCTCC
TGCACCCTGAACCACCAGAAACCCCAAAGGATTTCGTCTC
GCTCTCTTCCCTGTGCATGACCCCACCTCACAGTCCCAGC
TTTACTGAGACCTCCAACATCACATCAGTGCCAGCTTCTC
CCTCCCCACTTACCCGGCCCTGCCCCAGCCTCCCCAGCCC
CCAGAGATCTGCATGCCCCACCATGGCCTCCATCACTCAG
GTGCCCTCCTCCGGACATCCCACAGAAAGGACCACACCCC
CACCCTGCAGAGCCATGGCAACCAGCGTAATCCGCCATAC
GGCCGACAGCTTCCTTTACCAGAACATTCCACAAGCTGTC
CAGCCACAAAAGACTGAGAAAGCTCCCTCATCACCTAGCT
TGTGCCACCAGCCCCTCATAGACACCACAACAGCATGTCA
AAGCAGCAGATCTCCTTCAAAGGAGGAAAAGCTTTTCATT
ACATCCTCAACTCCTCATTCGCCACCTCCAACCTCTAGCC
CACCAATCATATGCCAGATGTTTCCCATGGCCCAACCTGG
AGTCATTTCAGCCACGTTTATTCAGAAGCCCAGCCCTGGG
GTGAAGTCTATCCTACCACAGCCGCTCCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations