Transcript

klf11b-201

ID
ZDB-TSCRIPT-090929-19686
Name
klf11b-201
Previous Names
  • klf11b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039389 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039389|OTTDARG00000028793|ZDB-GENE-061103-82 klf11b|OTTDARP00000031506 klf11b-001 LG_none BX927337.10,CR627496.8 Danio rerio protein_coding KNOWN, 1906 bp
GGCGCACTGAATTCCGGCGTGAGTCGCGTCACCGAGCGGG
CGGAGCAGCTCTGTGTCTTTGTTCTGCTCTACTTTTCATT
TAAGAATTTTTTCTTACGTTCTGATCAATGTCAACACGCC
AGTTTACGAACATGGAAGAAATATGCAAGGGAGCTCGGAT
GGAGGTCTGTGAAGATTTTTTAGACGTGAAGAAGAACAGT
GAATACTCTTCATGCAGTGCTCTGGAATACAATGATCTTG
AGGCTGCTGAAGCCCTGGTTTACATGAGCTTCTGGAGTCA
GATGTCTCCAAAACCCAACGTCTTCAAACCTCGTCCTCTC
ACGCCAGCGTCAGACTCCTGTGATTCCCTCCTGCACCCTG
AACCACCAGAAACCCCAAAGGATTTCGTCTCGCTCTCTTC
CCTGTGCATGACCCCACCTCACAGTCCCAGCTTTACTGAG
ACCTCCAACATCACATCAGTGCCAGCTTCTCCCTCCCCAC
TTACCCGGCCCTGCCCCAGCCTCCCCAGCCCCCAGAGATC
TGCATGCCCCACCATGGCCTCCATCACTCAGGTGCCCTCC
TCCGGACATCCCACAGAAAGGACCACACCCCCACCCTGCA
GAGCCATGGCAACCAGCGTAATCCGCCATACGGCCGACAG
CTTCCTTTACCAGAACATTCCACAAGCTGTCCAGCCACAA
AAGACTGAGAAAGCTCCCTCATCACCTAGCTTGTGCCACC
AGCCCCTCATAGACACCACAACAGCATGTCAAAGCAGCAG
ATCTCCTTCAAAGGAGGAAAAGCTTTTCATTACATCCTCA
ACTCCTCATTCGCCACCTCCAACCTCTAGCCCACCAATCA
TATGCCAGATGTTTCCCATGGCCCAACCTGGAGTCATTTC
AGCCACGTTTATTCAGAAGCCCAGCCCTGGGGTGAAGTCT
ATCCTACCACAGCCGCTCCTGATGAGCTCTCCGGTGCCTC
AGGGGACAGTGATGTTTGTGATGCCCCAGTCGCCAGTATC
TTCAACTCAACAGTGCCAGCAGACTGTTATGACCCTAGGC
AACACCAAGCTCCTGCCTCTGGCTCCCGCTCCTGTTTACG
TGCCCTCAGGGCAGAGCAGCGCCACACAGGTCGACTTTTC
CCGCAGGCGCAACTATGTCTGCAATTTCCCAGGCTGTCGG
AAAACTTATTTTAAAAGTTCTCACCTGAAGGCACATCTCA
GAACCCATACAGGAGAGAAACCTTTCAGCTGCAATTGGGA
AGGCTGCGATAAGAAATTTGCACGCTCTGATGAGCTCTCT
CGGCATCGGCGAACACACACAGGTGAGAAGAAGTTTGTCT
GTCCGGTGTGTGAACGACGATTTATGCGCAGCGACCATCT
CACCAAGCACGCACGTCGACACATGACCACCAAGAAGATC
CCATCTTGGCAAACAGAGGTGCGGAACCTCAACAAGATCA
CCGCAGCCAAGACTTTGCCTACTGGCACAGCACTGCCAGT
CAGCATGTTGCTGCCAGCCTCAAACTGACTCTGATGGAGA
CTGAACTTTCAGAGATGATATGCAAGGACTCATTTTATGA
CTGCTGAATCTCTCGTGAGCAAAAAAATCGATTTATGCAC
TGGACTCCTGTCTTTTTTGCTGCACATATTTCGCACTCTG
CAATGGAACATTTTGTTTACTATTGTGTAAAAGATTTATG
CACTCTTTTGCCAAAGTCTTTGTACTATGTTTGTCTTAAA
AATATTCCTTTTTCTTCTCTTTTGTATACCTTTATATGTA
CAGATCTAGCTGAAATATCTAGTGGGGCTACACACAATTA
GAAAAAGGAAAATATGTAAAAATGTATATGTGGATAATTA
TCTACACTGTGATTATCATATAGAACTTTTATTTAATACA
TTTTTTTATTAAACAATGAAGATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations