header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1751
Transcript Name: wt1a-201
Previous Name: wt1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050905 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050905|OTTDARG00000035742|ZDB-GENE-980526-558 wt1a|OTTDARP00000039978 wt1a-001 LG_none CU928058.6,CR762411.7 Danio rerio protein_coding KNOWN, 1874 bp
AAAAAAGAGCACTTTTTGCTGGCCGTGACCCAACTTGACT
TTGCGATGACACCTTGAGGTTGGATTTTAGCACTGAAGTG
AACTCAAAACTAGCTTGGACCTTGTGACTCAACTGGGCCC
ATTTGCTCTGCTCCTGAAAGTCCTCAAAATGGGTTCTGAT
GTTCGTGACCTCAACACTCTTCTCCCTCCAGTTCCACCGC
TGCCCGGTGGAAACGGTAACTGTACTCTTCCAGTGAGCAG
CACCCCACAATGGCCTCCGATGTTGGACTTTCACACCGGA
GCGCCATACGGCTCGCTGGCCCAGCACTCCTTCATCAAGC
AGGAGCCCAGTTGGGGAACAGCTGACCCTCATGAAGACCC
TCACTGTGGGTTGAGTGCCTTTACCGTGCACTTCTCCGGA
CAGTTCACTGGCACAGGGGCCTGCAGGTACGGAGCCTTCG
GGGCCCCTGCAGCAAGCCAACCTCCACCCAGCCAACCAAG
GATGTTCAGCAACAGCCCTTACCTGTCCAACTGCATGGAC
AGCCAATCCAGCTCCAGGAATCAAGGTTACGGCACGGTTG
CTTTTGACGGCGCCTCAAACTATGGCCACACGCCTTCACA
CCACACCCCGCAGTTCCCCAACCACTCCTTCAAACACGAG
GACTCAATCACACAGCAGAGCAACATGGGGGATCAGCAGT
ATCCCGTTCCTCCTCCAGTGTATGGCTGTCACACTCCTTC
TGACAGTTGCACAGGAAGTCAAGCTCTGCTGCTGAGAAAC
CCATACAACAGCAGCGATAATTTATATCAAATGGCGTCAC
AGTTGGAGTGCATGGGGTGGAATCCTGTCAACTCTCTGGC
GTCCACTATAAAGAGCCATCCAGGAGGTTATGAGAGCGAC
CCCAGCACACCCATGGTCTACAGCTGCAGCACTCAGTACC
GTATTCACACCCATGGCGTCTTCAGAGGCCTTCAGGATGT
GCGGAGAGTACCGGGCATCACTCCTGCCATTGTGCGTTCA
ACCGAGACCAACGAAAAAAGGCCATTCATGTGCGCCTACC
CTGGCTGCAACAAAAGATATTTTAAACTGTCGCACTTACA
GATGCACAGCCGTAAACACACAGGGGAGAAACCCTATCAG
TGTGACTTCACAGACTGTGGTCGCAGGTTCTCCAGATCAG
ACCAGCTAAAACGACACCAGAGAAGACACACAGGCGTTAA
GCCATTCCAGTGTGAAACCTGTCAGAGAAAGTTTTCACGT
TCAGACCACCTTAAGACCCACACCCGGACACATACAGGTA
AAACAAGTGAGAAGCCCTTCAACTGCAGATGGCCAAACTG
TCAGAAGAAGTTTGCCAGGTCAGATGAGCTCGTCCGGCAC
CACAACATGCACCAGAGGAATCTGACCAAACTCCAGCTAA
CCATCTGAACCCTTGTCCCAAACACAGAAACGGCAGGAAA
TAATCTTGTTTTCCTTTAAGCGTTCAGGTCTTGGAGTTAC
AACACAAGACAAAGCTACTCTTTATCTGCATGTGCAGCGC
CACCTAGAGGAACAAGCTCCAAACCTGGCCATGAAACACC
ATTACTGTGGTGCCAATAAACAACTGTGTTTCCAGTGAGA
AAACATTATGTCCTTAAGGCAAGACACTGCAGGTCGATTG
ATTACATTAAAAATTCAAATGGTTTTTTTTATATCTTAAG
TTTTCTAAAATGTAATGTTAAGATATGTAAACGAAGTATT
ATTTAATTAAATATGTGCTCATTTGCATATGCTTCTACAC
AGTATGTTTGGTAAAGTTTTTTTAAAAGTAGTATATTACA
ATCTTGAGTCACTTTTTTTTTTTTACAAAAAAGTAACTAA
ATGTGTTATTATATACATATAACTTGGTTATTTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
wt1a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000050905 (1),  Ensembl_Trans:ENSDART00000031499 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AF144550 (1) 1807 bp
GenBank:BC162638 (1) 1441 bp
GenBank:BC162349 (1) 1436 bp
GenBank:CT651355 (1) 814 bp
CITATIONS (2)