Transcript

lgi1b-201

ID
ZDB-TSCRIPT-110325-1725
Name
lgi1b-201
Previous Names
  • lgi1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050814 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050814|OTTDARG00000035679|ZDB-GENE-060217-1 lgi1b|OTTDARP00000039899 lgi1b-001 LG_ CU463858.11 Danio rerio protein_coding KNOWN, 2019 bp
CGCAGGTGCATCTCTCCAAAGCCTCATGAATATTCTCTCT
ATCACTTATTCATGGGCTCGGTTCATGCGCATTCACAGTA
ATAACACCATTGGACAGCAGCTGGTACATCATGATGCAAA
AGAGGGATTCTCCCAGGATCTGAAGGAATTGTTTGATCCT
CAAACGCGCGTCGGCAAGGAAAACATTGTGATCTTGAAAT
CTGAGCCCATTATAGCAGAACGAATCGCCTGGATGAGCGC
CTGACAGACTGAGACTCAGACATTCATCACACGGACACAA
GTGAAGGAGTCGAGCGGCAGAGCAGCTCTGATCACCCGCG
CAAACCCACACACACATACACACACCCGCGCAGGATGGGA
TATGCGAACAGGAGCATAAGAGCATACACTTTTCTGTTGT
GGGTCGCAGCGGTCCTGCTGTTTGCGGAGAGCAGAAGAGG
CAAACAGCCGAGATGCCCCTCTGGATGCACGTGCACCAAA
GATAACGCCTTGTGTGAAAATGTGAGATCTGTGCCTCACA
GCTTCCCTCCAGACGTCATCTCACTCTCGTTTGTGAAGTC
TGGATTCAGTGAGATTGCAGGGGGAAGTTTTCTCCACACG
CCGTCCCTTCAGCTTCTATTGTTTACAGCCAATTCTTTTG
ACTTGATTGATGAAGATGCCTTCCAAGGGCTGCCACATCT
GGAATATCTATTTATTGAAAACAACAAAATAGAGTCCATT
TCTCCCCATGCCTTTAGAGGATTGAAATCCCTCATTCACC
TGAGTCTCGCCTACAATAATCTCGAGACGTTGCCCAGAGA
TATATTCAAAGGAATGGATGCCTTAACAAAAGTGGATCTC
AGAGGAAACTTGTTCAGTTGTGACTGTAAGTTGAAGTGGT
TGGTGGAATGGATGTTCAGCACTAATGCAACGGTGGATCA
GTTATACTGCAGTGGGCCTTCACCCTATCAAGGGAAGAAG
ATAAATGACCTCATGCCTCAGTCCTTTGACTGCATTACAG
CAGAGTTTGCTTTAAAGAAAACCCTTGCATTTGAGTCTAT
ATCCGTGGAGGCCTTCTCCTATGGGAACGATCAGTATGTG
GTTTACGCTCAGCCTTTCACCGGAAGATGCAACTTCATGG
AATGGGACCACGTCAATATGGAGTTCAGAGATCATGAGAT
CATATTAAGCACCTCCACGGTGGTGTGCAAGCCAATGGTC
ATCGATGACCACCTCTTCATCGTGGTCGCTCAACTGTTCG
GTGGCTCTCACATTTATAAAAGAGACAGCTCAGCCAATAA
GTTCATCAAAATCCAGGACATCGACATCCTGAAAATCAGA
AAACCCAATGACATCGAGACTTTCCGTGTGGACGGCGAGT
TTTACTTCGTGATCGCGGACAGCTCCAAGGCCGGCTCTAC
TACGGTTTACAAGTGGAACGGCAATGGCTTCTACTCGCAC
CAGTCTCTCCATCCGTGGTACCGCGACACTGATGTGGAGT
ACCTGGAAATCGCAGGCAAACCCCACATTATTTTGTCCAG
CAGCTCACAGCGGCCCGTCGTCTACCAGTGGAGCCGAAGC
CAGAAGCAGTTCGACAGGCGGACGGACATTCCCGATATGG
AGGACGTCTATGCGGTCAAACACTTCAAGGTGAAGGGGGA
GCTGTTTATCTGTCTGACACGCTTCATCGGAGACTCCAAG
GTGATGAAGTGGGACGGCGCTATGTTTATAGAGATACAGA
CAATGCCTTCGCGGGGGTCCATGGTCTTCCAGCCCGTCTC
CATCGGCAACTGGCAGTACGCCATCCTCGGCAGCGACTAC
TCGCTAACGCAGGTCTATCAGTGGGACGCCAAGAAGAGCC
AGTTCGTACACTTCCAGGAGCTCAACGTCCAGGCGCCGAG
AGCATTTTCACTGGCCTCCATTGACAACCGAGAGTTCCTG
CTGGCGTCCAGCTTTAAAGGGAAGACGCAGATTTACGAGC
ACTTGATGATCGACCTGAGCAGTTAGGGTGCAGAAAACAG
ACCCTGACACAGACGAAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations