Transcript

map2k5-201

ID
ZDB-TSCRIPT-110325-1614
Name
map2k5-201
Previous Names
  • map2k5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050273 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050273|OTTDARG00000035343|ZDB-GENE-030131-1517 map2k5|OTTDARP00000039462 map2k5-001 LG_none BX511006.10,CU468958.6 Danio rerio protein_coding KNOWN, 3745 bp
AGATAAATGAACATGACCTCCAGTACCAGGAACAGCTTGG
CCATGGAAATGGTGGAACAGTTTACAAAGCCTATCACCTA
CTTGGGAAAAGAATAGTGGCAGTAAAGGTTATTCCTCTTG
ACATCACAGTGGAGCTGCAGAAGCAGATCATGTCAGAGCT
TGAGATACTTTATAAGTGTGATTCTCCGTACATCATAAAG
TTCTACAGTGCTTTCTTTGTGGAGAACAGAATATCGATAT
GCACTGAGTTTATGGATGGTGGCTCTCTGGATGTTTATTG
GAGAATCCCAGAGCATGTTTTGGGCAGGATTGCTGTTGCG
GTGGTAAAAGGATTAACGTACCTCTGGAGCCTGAAGATTT
TACACAGAGATGTCAAACCATCCAACATGCTGGTCAACAC
ACGAGGTCAAGTCAAACTTTGCGACTTTGGTGTCAGCACA
CAGTTGGTGAATTCCATTGCAAAAACGTATGTCGGAACCA
ACGCATACATGGCGCCAGAGCGGATATCTGGGGAACAGTA
TGGTATTCACTCTGACGTGTGGAGCGTAGGGATCTCTTTC
ATGGAGTTGGCTCTGGGCTCTTTTCCATATCCACAGATTC
AAAAGAACCAGGGCTCTTTAATGCCTCTTCAGTTATTGCA
GTGCATTGTTGATGAGGATCCCCCTGTACTTCCAGTTGGT
CAGTTCAGTGAGAAATTTGTCCACTTCATTACACAATGTA
TGAGGAAGCTGCCCAAAGAAAGACCAGCTCCAAACAACCT
GATGGACCACCCATTTATTGTGCAATATAATGATGGCAAC
ACTGAGGTGGTGTCCATGTGGGTGTGCCGCAGCCTAGAGG
ACCGCAAAGCCCAGCAGCCACAGAGACTCATGTGAACAAC
ACTGACACTGCAGGGAGTTATGGGAGATGGTGTCCACATT
CCCTCACTTTACTCTTCCACTGAGAAACAGCAGCTCACAT
ATAGAGCACCTCCTCCTCCCATGCTTGAATTTAATGGTGC
ACGGTGAGATTATGCTAGCATCCTGCAAATGAGGATTTTA
ACCGTGTATATTGGTTTCCACTGATGCAAATCTTCAGCTT
TGTTCTTCTGCAGCCTCTTTTTTTTTAAGTAAATGTTTCC
CCAGAAGATCATCACAGGGGGGATGTTGCTTGCTCAACTC
AGCTTTCGTTGAAAATACCATCGCTTTCTGTACTTAAAGC
AACAATCTGGTTTTGCCAAAACATTGTGGGCACGTCATAA
ATCATCTCGAGTTCAGTGAAACATTACGGTTTTCAAATAT
ATGGGGTTGTGTGGAGCATTGCCCCCTGCTGCAGTGCAAG
TCATGCTGCTGTTGTTTTAAAAGCCACTTTTTTGTCGAGT
TTCACAAATGGCCTGCCAGTAGTGGCAATACCCAATTGAA
GTTAGAAAAATGTGATGCCTTGTTATGGTGGAAGGCGGTG
GACGGCAGCTTGTGCACATAAGCTTGAATTTTCTTCCTGC
CCTTGTCCTACATAAGGCCAGTTTTGAACTTTATTCAAGT
ACATATAAACTTAACATTACTTTAAGGTTTGATACGTTTT
TAGATCTATGTACACTACCATTTAAAAGTTTTAGGATTTT
TTAAAGACATTCTTTTTCTTAGCAAGGATGCACTGAAGTG
CTCTTATTATTATGCTATTTTAAACGTCTCCATTTTTTGG
AGTTCTCCAATAATAGGTTTACACAAATCCAAGGTCAAAA
AACGTTACGTTTCTTTTAATGTACATTTCACGTCACATAA
AATTGTAAAAAGCATATCAAACAATTCCCAGTCTGTTGAG
ATTGGTCTATTACTTGCAGTAACAATAACAATGGTGCTGC
TGATTTCACCATATTAAACCTTAACAGGCCACTCATTAAA
CTCATCAGTGGTTACTTTGGGTTACTACAATACTATTGAA
GTATTTTACTTTTATGACCTTAATGAAATTATTTTAATGT
AATCAATGTAAATGAAGTTACCGTATATGATAAGGGGGTA
AATCGAAGTCCAATGATGAAACATTTGAAAGCTAGGTGAT
CAACCCGAAGCTCTTGCATGACTCAAGCAGGACATTTCAG
AGAATATGAATTAATCACATTCCTATTGAGTTCATGACCA
ATCAGAGGCTTTAAGATCAGTACACACTGGAGGTTGCGCA
CACTCTTTTGAAGATTTTTTCATTAACTAAAGTGAATATA
CGATTGATTGTACTTAACAGATTTGATAAGCAGCTTCAGT
CATTCTAACAAGAGTTTTTGTGAGGATGCATCAACAAAAA
ACTGTCTTTTTTGACATGTTGTTGACGAAAAACTACAGAA
TGTCAGGGTGGGTCATAGTAAATGTATTCACGGGCAGCTG
ATTTGCATTATGGAAATCTGCTTTGTATATACATAAATCA
GTAACAAATGTGAAATTGGAATTGCTGAGGGATCATTTTG
TTTTTAACAATCTGCTCTTTCTTTTTGGTTGATCAAAAAT
TCAGTTTTGTTTATCCATTCATTCATTTTCTTTTCGGCTT
AGTTTCTTTATTCATCAGGGGTCAGCACAGCAGAATAACC
CGCCAACTTATCCAGCAAATGTTTTACGCAGCGGATGCCC
TTCCAGCTGCAACCCAGTACTGGAAAACATACATACATTC
ACATTCACACACACACTCATACAATTCGGCAAATTTAGTT
TATTCATTTCACCTATGGTGCATGTCTTTGGACTGTGAGG
GAAACAGGAGCACCCGGAGGAAACCCAGGCCAACACTGGG
AGAACATGTAACCTCCATACAGAAACTCCAACTGACCCAG
TTGGGACTCAAACCAGCGACCTTCTTGCTGTGAGGTAACA
GTGCTAACCACTGAGCCACTGCGTCACCCAATTTTGTTAT
TAAAGGAACAAAAAAATTATATTAAAATATTTCTTTAGAA
GACTGTTATATTAAATTAACACTTTGCCATTGTGTTGCTA
AGAAGTTGCTTTTTAAAACCAGTTACAATAAATCCCACCA
AGCTCAAACTTTTGATTGGTAGTGTACATTTCAATGTTAT
ACTGCAAATCAGGTGAGTCTCATAAACTATTTAGAAAAGA
AAATTGTAGAAATTAACTTAAGATGAGAATACAGATGAGA
ATGTAAATTAAATCACATTAACCCAGACAATATCAAAATA
TCCCTCCCATACAGACAGATTAACACAGCAGGATTCACAG
TGCTGGTGAAGAATGCCAAGAGTGACTCATAAAATCCCCT
AACACTCCTTTAAGCCAGGATTTTCTGGTAAAATGGTAAG
CAGGCCCCCAAACAATACAAATGTATACATCTAAATGAAC
TGTATTCTTTTTCCTGAGGATTTGATTAAAATGAACCAAA
AGTTGATAATCAGCCCCACCGTTCATCACATCTGCCTTCT
TTTCTGACATTTCAGGAACAATTTTGATGTTTTATCAGTG
TTACTTGAGCGATCATTTTAAATGCAAGTGGCAGTAATTA
TTATTATTTAGATATTATCTGTGGTCACAACTGCCAGTCA
CCATTTTATAAAATGGTAAATTGTCAAACACCAAAGCCAA
ATACACAGTACTTTTTTTACTGTACTATTATTTATAACAT
TTGTTAATGTTCAGCTATGTCAAATTAATTTCTCAGATTA
TAATGAACTTTGGCCAAAGCCAAGCCTGACTAGCGACCAT
ATAATGCAATTGAGGTGAGGTTTGCACATAAAGCTGATTT
TCTTAATAAAATATTGCAGATTTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations