Transcript

aurka-202

ID
ZDB-TSCRIPT-110325-1562
Name
aurka-202
Previous Names
  • aurka-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050080 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050080|OTTDARG00000035228|ZDB-GENE-040801-161 aurka|OTTDARP00000039310 aurka-001 LG_ FP017176.3 Danio rerio protein_coding KNOWN, 1098 bp
GTATTTTAAAAGTGGGACATTTGAAATTAAACAGGTCGCA
GTTGCAGGGCAGGATCGCGTCGCCATCTGTAGAAAAGGAA
ATATAGTTATTAATAATTTTTCTCGATATTAAACCTCCCA
CGCGGCTCCTCCAGCGGATGGTAAAGCGTTTATAGCACTG
AAAGCAAGACATCGTCGAGTTTGTGTGGGTTTGAGCAGGA
TTTGTCGTGTGGAAACGGCTGACGGAGATATGGACTCTGG
TGCAAGAAGCAAATCAAGCAGAGATCTGAAGATTCATCGA
CCTGAAAATGAGAAGGTTTCTGCCGCTGGACCCAAAAGAG
TTCCTGTAACCCAGAGCGTGCAGAAGCCAGTGTCGAACCC
ACACACGCGTGTTCTCGGCGCTGCACAGGGACCACAGCGT
ATCCAACGTCCTGTTGGGAAAACCTCTTGTCCTGGAGACC
AGAACACTCGTCCAGAACAGCACAAACCAGCAGCGCACAG
CAAACCACAGCCAAAACCACCGCTGTCAGCGGAGACCAAC
AAAACTGCAGAACCCAGCAAACAGGATAAACCTCACCAAA
CTCCTTCCAGTACTACTTCTACCTCCTCCAACACCAGTGG
ATCATCGAAGAGTTCAAAAAAAGCCTGGACTTTGGAGAAT
TTCGACATTGGCCGCGCTCTGGGCAAGGGGAAGTTTGGCA
GCGTGTATCTGGCCAGAGAACAGCAGACCAAGTTTATTCT
GGCGCTCAAAGTTCTGTTCAAGAAGCAGCTGGAGAAAGCA
GGAGTGGAGCATCAGCTGCGCAGGGAGGTGGAGATACAGT
CACATCTCAGACATCCCAATATCCTGCGTTTGTATGGTTA
TTTCCACGACGCGGCCCGTGTTTACCTCATCCTAGAGTTT
GCTCCTAAAGGAGAGCTGTATGGAGAACTGCAGCGCTGCG
GGACGTTCGATGACCAGAGAAGCGCCACGTATATAATGGA
GTTGGCGGATGCTCTGAGATACTGCCACTCGAAGGCTGTG
ATCCACAGAGATATTAAACCTGAAAACCTGCTGCTGGGAG
CCAATGGAGAGCTGAAGATTGCAGATTTTGGCTGGTCCGT
CCACACGCCCTCCTCCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations