Transcript

rpl5a-201

ID
ZDB-TSCRIPT-110325-1344
Name
rpl5a-201
Previous Names
  • rpl5a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049186 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049186|OTTDARG00000034705|ZDB-GENE-030131-5161 rpl5a|OTTDARP00000038597 rpl5a-001 LG_ CU855908.4 Danio rerio protein_coding KNOWN, 1039 bp
TTTTCTCAGTGCAGCGGGAGCAGTATCGGAGTCTGAAGAG
TTCAGTCTCCCAACCTAAAGGAGAACAAACGATCACAAAA
TGGGTTTCGTTAAGGTTGTTAAGAACAAGTCGTATTTCAG
GAGGTACCAGGTGAAGTTCAGGAGAAGGAGAGAGGGGAAA
ACTGACTACTTTGCCCGTAAGCGTCTTGTCATCCAGGATA
AGAACAAGTACAACACACCGAAGTACAGGATGATCATTCG
GTTCTCCAACAGGGATATTGTTTGCCAGATCGCATATGCC
AAAATTGAAGGCGACGCGATCGTCTGCGCTGCTTACTCTC
ACGAGTTGCCAAAATATGGCATTGCTTGTGGACTGACCAA
CTACGCTGCGGCCTACTGCACCGGTTTACTGTGTGCTCGC
AGGCTGCTGAATAAGTTTGGTCTGGATAAGGTCTACGAAG
GCCAGGTTGAGGTGACAGGCGATGAGTTTAACGTGGAAAG
CATTGATGGCCAGCCAGGGGCTTTTTCTTGCTACCTGGAT
GCCGGTTTGACTAGAACCACCACAGGGAACAAAGTGTTTG
GAGCTCTTAAAGGAGCAGTGGATGGAGGACTGTCCATTCC
TCACAGCACAAAGCGGTTCCCGGGCTATGACTCTGAAAGC
AAAGAGTTCAATGCGGAGGTGCACAGGAAGCACATCTTGG
GTCTGAATGTGTCCGAGTACATGAGCCTTCTGATGGAGGA
GGACGAGGAACTGTACAAGAAACAGTTCTCCCGCTTCATC
AAGAACGGCGTCACACCTGAATCTATTGAAGAGATGTACA
AGAAGGCTCATGCTTCCATCCGTGAGAACCCTGTTCATGA
GAGGAAGCCCAAGAGAGAAGTCAAGAAGAAGAGGTGGAAC
CGTGCCAAGCTCACTCTGGCCCAGAGAAAAGACCGTGTGG
CCCAGAAAAAGGCCAGTTTCCTCAGGGCTCAGGAAGCTGC
TGCAGACGACTAAAGAAATCAAACGTCAACGGCTCCAAAG
AAAGTGTGCACCTTTTCCAAATAAATCATTTGGAAAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations