Transcript

thbd-201

ID
ZDB-TSCRIPT-110325-1303
Name
thbd-201
Previous Names
  • thbd-001
  • ch1073-471m19.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049059 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049059|OTTDARG00000034635|ZDB-GENE-110411-281 thbd|OTTDARP00000038497 CH1073-471M19.4-001 LG_ FP017156.4 Danio rerio protein_coding NOVEL, 1402 bp
TGGGAAATGTTTTGTCGTCCAGACCGACACCGCGAACTTT
GACGCGGCGCAGAAAGTCTGTGAGGAGCGAACAGGACATC
TGATGACCATCCGCACCGCAAAACTAGCCGATGTGTTATC
TCGGTTATTATTAAAAGGAGAGTCGGGAAACTTCTGGATT
GGGCTGAGATATGTCGGTAATGAGTGTTCAGATAGATTAA
AGGGATATAAATGGATCACTGGAGATGACACGAGCCACTT
TTCCAACTGGAAAAGAGAATCAGATTGTGCGCCAAGTTGT
GTTTCGGTATCACAAAACGATCACAAATGGACAGAGAGAC
CGTGCAGTGACCGAATAGATGGTTATGTGTGTGAATATAA
CAATTTAAATCACTGTCCGCCGCTCAGCACTGATGAAAAA
GTCCATTATTCGACTGCTTTTGGATTTACATCAAACGAAC
TCCTCAGAGAGATTCCCGAATTGACTAATGCAACAAGGCT
TGATCTTAGGACCAAACACATTTGTTTTGACAGCGAGTGG
CTTCATGCGCCCTGGAACTGTGAGGTTTTTGATGGTGGAT
GTGATTATACGTGTGTTAGGAACGGGCAGAGCTACGCATG
CATCTGTCAGCCGGGATTTAAGCTGGACACAAACGGGATA
TCGTGCAGCCAGCAGCAGGACGATGACCCGTGCGCGCATG
CGGGATGCGAACACGAGTGCGCGCGAGATAGCGGTGCGTT
CGCGTGCACGTGTCGCCCGGGGTTTACCCTGAGTGCGGAC
GGAAAGTCTTGCAAAGAGAACTGCAAGCCCGGCTATATCA
ATGAAAACGGCGGATGCGTTGATGTTGACGAATGCGCAAC
AGGACCGTGTGAACACGACTGCGCCAACACTGAGGGCAGC
TATCAGTGCGTATGTTTTGATGGATACAAACCGGCAGCTA
AGGACATGCACAAATGTAAAATGCACTGTCCGGACATGAG
ATGCAAGGCTGAATGTGATCCCAATAATGATTACCAGTGC
GACTGCCCTGATGGTTTCCTATTTGACGAAGATGACAGAT
ATTGCGTTGATGTAGATGAATGCATAAGTACCAATGACTG
TGACCAGAATTGTACAAACACACCAGGATCATTTGAATGT
TTTTGTCATGAAGGATACGTGCTTTTGGACAATGGGGTGT
GTGAAGACTTGGAGGGTTCAGGCAGCTCAACGCCTTTTGA
CCTTTTCATTCCCACAAGCAGACCCCCAACCGACCGGCCA
CTGTCCATTTCTGCGGGCAGTCTTTTGGGAGTAATGGTCT
GCGTTGTTGTTTGTGTGCTGCTACTGGTCTGCCTTGCGCA
CTGCATACTGAGACGACTGAGTAAAACGAACCATTACGAT
ACACATAAAGTCCACGATGAAATCTACGATTTTCAACAGG
TG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations