header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1252
Transcript Name: sprb-201
Previous Names: sprb-001, ch73-368o6.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048892 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048892|OTTDARG00000034541|ZDB-GENE-070719-1 sprb|OTTDARP00000038368 CH73-368O6.3-001 LG_ CU469500.10 Danio rerio protein_coding NOVEL, 1409 bp
ATCATCATCCGAGAGCGTGTGAGCTATGGACAGCGTGTTG
TGCAGCGAGCGTAGGGATCTGGGCCGTGCGGTGTGTGTGG
TCACCGGAGCGTCGAAAGGCTACGGCCGGACGCTGGCTCT
GCAGATCAGCTGTTTACTGAAGCCGCGCTCCGTCCTGCTG
CTGGTGTCCCGAACCGCAGACCAGCTCAACCAGCTGAAGC
AGGACATCGTGAGTCTGCACGCGGCACACACTGATCTGCA
GCTGGACGTGCGCTGTGTGCAGGCCGATCTGCAGGAGCCC
GACGGCGTGCAGAAGACCATACAGGAGACCAGAAACACTC
TGAGCACTGATATAGAGCATCTGCTGATCATCAACAACGC
AGCATCTCTGGGTGACGTGTCCCGCTGTGCTGTGAGCTTC
ACTGACCCGTGTGAAGTGTCCCGGTATCTGGCTCTGAATG
TGAGCGGTGTGTTGAGTCTGACGGCGGGGATCCTGCAGGC
GTTTCCTCCAGCGGTCGGCCTGCGCAGGACGGTGGTCAAC
ATCAGCTCTCTGTGCGCCCTCAAGCCCTTCCCCTCATGGG
TGCTGTACTGCACGGGGAAAGCGGCCCGAGACATGATGTT
CAGGGTGCTGGCGGAGGAGGAGCCCGACCTCAGAGTGCTC
AGCTACGCCCCTGGGCCTCTGGACACTGACATGCAGCTGC
AGGCACGCTGTTTTTCAGGTAATGTAGAGCTGCGGCGCTC
TTTCTCCTCCATGTTTTCTGACGGTCAGCTTCTGTCCTGC
GAAGAATCCGGAGCAAAACTCATGAAGATCCTGCTGGACG
ACCAATATCCGTCAGGTGCTCATCTGGACTACTATGAGCT
CTAGAACCTGCCGCTCCGGCCTGTGCAGACATACAGCTCA
AGACACAATTATTAGTTATTCTGTGAATTTCTTCTTCAAA
TATTTCCCAAATGATGTTGAACAGATTCAGGAGTTGTTCA
CAGTGTTTCCTCTAATATTTGTTCTTCTGGTGAAAGTCTT
GTTTGTTTTATTTCGGCTAGAATAAAAGCAGTTCTTAATT
GTTTAAAAGTCATTTTAAGGTCAATATTATTAGCCCCCTT
CAGCAATATTAGTTTTGGATTGTCTCCAGAATAAACCACT
GTTATACAATGACTTGCTTAAATATTAAATACTAAATTTA
ACAAGAGGGTGAATAATTCTGACATTTCTAATCATAATAG
TTTAATAACTCATCTCTAATAACTGATTTATTTTCTCTTT
GCCATGATGACAGAGTATATTATTAGAGATATTCTTCAAG
ACACTAGTATTCAGCTTAAAGAGACATTTAAAGGCTTCAC
TAGGGTAATCAGGGTAAAGTTAGTGTAATTAGGCAAGTCA
TTGTATAACAGTGGTTTGTTCTGGAGACAATCCAACTCTA
ATATTGCTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sprb-201 Contained in:
[BAC] CH73-368O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000048892 (1),  Ensembl_Trans:ENSDART00000081432 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC163650 (1) 1086 bp
GenBank:BC163662 (1) 1086 bp
GenBank:CK680449 (1) 751 bp
CITATIONS (2)