Transcript

map2k7-201

ID
ZDB-TSCRIPT-110325-1191
Name
map2k7-201
Previous Names
  • map2k7-002
  • ch211-254d18.2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048614 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048614|OTTDARG00000030074|ZDB-GENE-090312-186 map2k7|OTTDARP00000038142 CH211-254D18.2-002 LG_ BX901938.5 Danio rerio protein_coding KNOWN, 1317 bp
ATGTCGTCGCTGGAGCAGAGACTCTCCCGAATCGAGGAGA
AACTCAAGCAGGAAAATAAAGAAGCTCGCAAACGGATCGA
CCTGAACATCGACATGAGCCCGCAGCGGACGCGCCCGAGG
CCAATCATCGTGATCCAGCTCAGTCCAGCTCCAGCCCCTT
CCCAGCGCGCAGCTCTACAGTTGCCTTTGGCCAACGATGG
AGGCAGTCGCTCGTCCTCGTCAGAAAGCTCCCCTCAACAC
CCCTCGTACCCCAATAGACCCCGACAAATGCTCACACTTC
CCACAACACCGTACAACCTACAAAAGAACCTGGAGAATGC
TGAAATCGATCAGAAGTTGCAGGAAATCATGAAACAAACC
GGATATTTGAAGATTGATGGACAGCGTTACCCCGCAGAGG
TGACTGATCTAATCAGTGAGGGGGAGATCGGCAGTGGAAC
CTGTGGACAGGTGTTTAAAGTTCGTTTTAAGAAGACTGGC
CATGTCATCGCAGTCAAGCAAATGAGAAGAACGGGTAACA
AAGATGAGAATAAGAGAATCCTCATGGATCTGGATGTTGT
ATTGAAGAGTCACGACTGTCCATACATCATTCAGTGCTAT
GGGGCAATAGTCACCAATACGGATGTGTTCATTGCCATGG
AACTAATGGGAACGTGTGCAGAGAAGCTGAAGAAGAGGAT
CCAAGGGCCCATACCAGAGGCCATTCTGGGAAAGATGACC
GTGGCTATTGTGAATGCTCTGCTTTATCTAAAAGAGAAAC
ATGGTGTCATACACCGAGACGTAAAGCCATCTAATATCTT
GTTGGACGCCAAAGGGCAGATCAAACTGTGTGATTTTGGC
ATTAGCGGTCGATTGGTAGATTCTAAGGCCAAGACTCGCA
GCGCCGGCTGTGCTGCGTACATGGCGCCTGAGAGAATAGA
CCCTCCAGACCCCAGTAAGCCAGATTATGACATCAGAGCC
GACGTCTGGAGTCTTGGCATTTCTCTGGTGGAGCTAGCCA
CAGGACAGTTTCCTTACAAGAACTGCAAGACAGACTTTGA
GGTTCTTACCAAAGTTCTGCAAGAGGACCCGCCAGTGCTT
CCTCTCAGCATGGGCTTTTCCCCTGACTTTCAGTCCTTCG
TCAAAGACTGCCTCACAAAGGATCACAGAAAAAGGCCAAA
ATACCACAAGCTGCTTGAACACAGTTTCATCCGTCGTTAC
GAGGTGTCAGAAGTGGACGTTGCGGGCTGGTTTCAGGCGG
TGATGGAGCGCACAGAGTCTCCTCGCAGCAGTCAGTGCTT
CAGCCATCACCAGCTCCACTCTCTCTTCAGTAGGTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations