Community Action Needed: Please respond to the NIH RFI
Transcript

map2k7-202

ID
ZDB-TSCRIPT-090929-21514
Name
map2k7-202
Previous Names
  • map2k7-001
  • si:ch211-254d18.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041463 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041463|OTTDARG00000030074|ZDB-GENE-090312-186 map2k7|OTTDARP00000033119 CH211-254D18.2-001 LG_ BX901938.5 Danio rerio protein_coding KNOWN, 1290 bp
GGTGCTGCAGAAGTTTTCAAGATGTCGTCGCTGGAGCAGA
GACTCTCCCGAATCGAGGAGAAACTCAAGCAGGAAAATAA
AGAAGCTCGCAAACGGATCGACCTGAACATCGACATGAGC
CCGCAGCGGACGCGCCCGAGGCCAACTCTACAGTTGCCTT
TGGCCAACGATGGAGGCAGTCGCTCGTCCTCGTCAGAAAG
CTCCCCTCAACACCCCTCGTACCCCAATAGACCCCGACAA
ATGCTCACACTTCCCACAACACCGTACAACCTACAAAAGA
ACCTGGAGAATGCTGAAATCGATCAGAAGTTGCAGGAAAT
CATGAAACAAACCGGATATTTGAAGATTGATGGACAGCGT
TACCCCGCAGAGGTGACTGATCTAATCAGTGAGGGGGAGA
TCGGCAGTGGAACCTGTGGACAGGTGTTTAAAGTTCGTTT
TAAGAAGACTGGCCATGTCATCGCAGTCAAGCAAATGAGA
AGAACGGGTAACAAAGATGAGAATAAGAGAATCCTCATGG
ATCTGGATGTTGTATTGAAGAGTCACGACTGTCCATACAT
CATTCAGTGCTATGGGGCAATAGTCACCAATACGGATGTG
TTCATTGCCATGGAACTAATGGGAACGTGTGCAGAGAAGC
TGAAGAAGAGGATCCAAGGGCCCATACCAGAGGCCATTCT
GGGAAAGATGACCGTGGCTATTGTGAATGCTCTGCTTTAT
CTAAAAGAGAAACATGGTGTCATACACCGAGACGTAAAGC
CATCTAATATCTTGTTGGACGCCAAAGGGCAGATCAAACT
GTGTGATTTTGGCATTAGCGGTCGATTGGTAGATTCTAAG
GCCAAGACTCGCAGCGCCGGCTGTGCTGCGTACATGGCGC
CTGAGAGAATAGACCCTCCAGACCCCAGTAAGCCAGATTA
TGACATCAGAGCCGACGTCTGGAGTCTTGGCATTTCTCTG
GTGGAGCTAGCCACAGGACAGTTTCCTTACAAGAACTGCA
AGACAGACTTTGAGGTTCTTACCAAAGTTCTGCAAGAGGA
CCCGCCAGTGCTTCCTCTCAGCATGGGCTTTTCCCCTGAC
TTTCAGTCCTTCGTCAAAGACTGCCTCACAAAGGATCACA
GAAAAAGGCCAAAATACCACAAGCTGCTTGAACACAGTTT
CATCCGTCGTTACGAGGTGTCAGAAGTGGACGTTGCGGGC
TGGTTTCAGGCGGTGATGGAGCGCACAGAGTCTCCTCGCA
GCAGTCAGTGCTTCAGCCATCACCAGCTCCACTCTCTCTT
CAGTAGGTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations