ZFIN ID: ZDB-TSCRIPT-110325-1041
Transcript Name: tbr1b-201
Previous Names: tbr1-001, tbr1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047980 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047980|OTTDARG00000034010|ZDB-GENE-000323-1 tbr1b|OTTDARP00000037646 tbr1-001 LG_ CU651665.6 Danio rerio protein_coding KNOWN, 3855 bp
GCTGTCTTGCACAAAGTAGCTCGAACCGCAGGAAGGCGTT
AGTTTTCTCTCGCGCTCGCGTTAATTGCTATTTGTCATCG
AGAGATGCAGCTCGAGCGTTGCATCTCGCCAGCTCTCGCG
CGCTCCAAGAAATGTATGATTGTGGGCAGTGGCTACCCAA
ACGCACAAGCGTCTGAGCTCGCCTTGCAGGACTACCCTAT
TATATCAATCGGCGACAACCTGGAGAGAAGTTCACCTCTG
AAAAAAAACTCCGCTGGGATGACGAATCAGTCAGAGGCAG
ACAATTTCGCCGACTCGAAGGACTCATCAGGGGACGTCCA
GCGAGGCAAACTCTCTCCTGATCTTGACGGAGTCGCCGAC
AGTCGTCACACTTTCGATGGATCTGCAGGAGAAAGGTATC
TCCTGTCTCAGTCCAGTCAAGTTCAGCCGAGTCCTACCAC
CATGTTTCCCTACCCGAGTCAGCATGGACCGACGCACCCG
GCTTTCTCCATCGCCAGCCCGAGCCGCTACATGGCGCACC
ACCCGGTCATCACGAACGGAGCCTACAACAGCCTATTGAG
CAACTCTTCTCCGCAAGGTTACGCGACCGCCGGGTACCCG
TACGCGCAACAGTATGGACACGCGTACCAGGGCACGGCTT
TCTACCAGTTTTCCTCCGCGCAAGCAGGACTCGTGCCCGG
CAAAGCGCAGGTTTACCTCTGCAACAGGGCCCTGTGGCTT
AAATTCCACAGGCATCAAACGGAGATGATTATTACCAAGC
AGGGACGACGAATGTTCCCGTTTTTGAGTTTCAATATATC
TGGTCTCGACCCAACGGCGCATTACAATATCTTTGTGGAC
GTGATTCTTGCTGATCCGAATCACTGGCGCTTTCAAGGAG
GAAAATGGGTCCCGTGCGGCAAAGCGGATACGAATGTAAC
AGGGAACAGAGTGTACATGCACCCGGATTCGCCAAACACC
GGCGCGCACTGGATGCGTCAAGAGATTTCCTTTGGAAAAC
TTAAGCTAACCAACAATAAAGGAGCAACCAACAACACAGG
ACAGATGGTCGTCCTGCAGTCGCTGCATAAATACCAGCCT
CGACTGCATGTGGTGCAGGTGAACGAGGACGGAACGGAGG
ACACGAGCCAACCCGGGCGCGTGCAGACCTTCACTTTCCC
CGAGACGCAGTTCATTGCTGTCACCGCATATCAAAACACT
GATATCACGCAGCTAAAAATCGACCACAACCCATTCGCGA
AAGGATTCCGTGACAATTATGACACTGTCTACACAGGCTG
CGACATCGATCGGTTGACGCCGTCCCCGGGTGACTCTCCG
CGCTCTCAGATCATGCCTAGCGCAAGATATGCCATGACTG
GTTCTTTCCTGCAGGACCAATTTGTCAGCTCGTATGCCAA
GTCCCGCTTTCACCCTGGCGTCGGAGGCGCTCCTGGCACG
GACCGCAGCGTCCCACTTAGTAACAGCTTGCTCTCCCCGC
AACAAACCGAGGAGACCACGGTGGCCTCCCCGCAGCGATG
GTTTGTCACCCCTGCCAACAACCGACTGGACTTTGCCGCC
TCGGCATACGATGCTGCTGCGGCTGCTGATTTCGCCGGTA
ACGCGGCCACCCTTCTGTCGTACGCAGCTGCCGGAGTTAA
AGCGCTGCCCCTGCCCGGTGCGGGATGCTCCAACAGACCT
CTGGGGTATTACGGCGAGCCGCCGGGGTGGGGCACCCGCA
CACCACCGCAATATTGCAGTAAATCCAGCTCTGTTCTGTC
TTGCTGGCCGTCCAACTCCGTAGGGAGCAGAACGACCGCC
TCAAGCTACCTGGTCCCGGGACTAGAGGACGGAGACCCCA
TTGCGCCCGAGAGGTCACCGCTAGGCGGGGCGGATGAGTC
CAAACCTAAAGACCTGTCTGAATCCAGCTGGATAGAAACC
CCGTCCTCAATTAAGTCGATCGATTCGAGCGATTCTGGGA
TTTTTGAGCAAGCCAAGCGGAGGAGGATTTCGCCATCTGC
CACGCCGGTTTCCGAGACGTCGTCTCCATTAAAATCTGAA
ATGTTGACGCCGAGGGAATGCGAGAAAAACTGCTCCAAGG
ACATCGGCTACTACAGCTTTTACCCCCACAGTTAGAAAAC
TCGGACCGACTAATGCATGGCTTGTGTGTTCAAGGATTCA
CAAAAGTGACTTATAATCTATTTATGTCCTGCTATTTATT
TATTTGTTTATTTATTTGCTCTTATATCCGGTCGCGTCGT
TCTAAGGACGCCACGCGTCGAGTTTTAACGGAAAAAAACG
GACACTTGATCAAATATGTACGCGGTTTTCGTAACCAAAT
GACATTTTAAGGTTTTAACTGTCAAACCTATTGTAAGTAT
GAAAGTACTGTACATAATTGTATTTATCTATTCATTTGTG
ATTCTTCTCGTTGAATGTTGATGTATAATATAGAAAACCT
AATTAGGTTTATGTTAAATGTACTTAGAAAACGTACTTAC
GTTCGTTAGTTCGAATAGCTACATATATTAAATATTTTGA
TGTCTGAAAAAATAAGGATACATCTCGTATAGGTTCCAGT
TGTGATGACAAAAACGATACGACTGAATTGGAAGTAGCTG
CTAATCCGTTGAAAAGCCCGCCAAAAAGAGTTCCTCTGAC
AGGAAAAATGGCGGACGCATGTCTGTCAGAGGTTGATTTT
ATGTGAGCTTATATTGATGTTGCTTTTAGAGTCGCGTCGT
TTGTTCGTAAATATCATAGTCCGTAGTTTCATTTTGTGAA
CCTTGTTGAAATGTTTTTAACCACACCAGCGTAAAATCAT
TTATCCCATTACCTTTTTTTTGTAGAGATAAAAACATAGA
CAACCATTCCACGTATTAACAACCCAGGCATTTCATTTGT
ATTTCATGGGTTGTTTTCTCATGAGGAAAATCGCGAGTTA
GGCCTGCTAATGTGTAAAGCTAATGTAATTTGTGGTGTGC
TTACTTGCAATAAATGTGACAGAATGTGAAACCCCGGGCA
AAGTACACAAGCTTCAAGCTAAGCTGATTTCAAAACCAAA
TATTTGTACCATTTTCTCTACCTGTTCTTGAGGTATATTG
AAACGCCAGTCACAATGTGAATTCCGTTTCCTGTTCGATG
CATTTTCATAATAAAATGTAGTCATGCAATGCAACAATTA
AGATAATCGCCCAGAACAAACTCTTTGGTAGTTCTCTACA
ATTTATAGATGGATTTTTTACTGCAATTTATAGAAGCCCA
AAAGGTAAACAGTAGTGTTAATAACAAAATAACAGACCAG
ATACATTTAGATAATGAGATTTAAGTGAATATATATGGGC
ACATTTTGGTTGTCAAATATAGGCGGTGTGAGCATTACAC
CTGTGATTTTATATGGTCCATTTCAGGGCAAATTTAATTG
GATTTTAAACCCATTCATGACCTGGATTTTAAAAAAACAG
ACCAATGTTTATGTTTTTAAGGCCTTTTGAATTAGGGTTT
AGATATTGTAGTGACCTGATTCATTAAAACTCTGCTGTAA
ACACCTTCATAAGCAATTTTGAATGCATCCACAATAAACC
CCACCACCGCTTGGGTAATATTAATTACAGAAAGTTAAAG
GCAGTTCAGTTAATTTGTTAGTATGGTTGATATTTTAATG
TAGTGCAATTACATTGTTTTAGGTTTGACTTGCATCTAGA
TATTATTATTGCACAATCTAAAACATGACAATATTTTATC
AATCATGATAAGAGGTCAATATGATAAACATTTCTGTTTT
TTTTTTTTTCAGTTATTTAAGCTCGTTTACATCCACATGC
AACCTTCATATGTATGTAAATGAGCGGTATGCTATTATTA
AACAGGCAGACTGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tbr1b-201 Contained in:
[Fosmid] CH1073-192A6 (1) (order this)
OTHER tbr1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047980 (1)
  • Ensembl_Trans:ENSDART00000006612 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC168510 (1) 3941bp
    GenBank:AF287006 (1) 2214bp
    CITATIONS (2)