Transcript

ctnnb1-201

ID
ZDB-TSCRIPT-110325-1028
Name
ctnnb1-201
Previous Names
  • ctnnb1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047938 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047938|OTTDARG00000033990|ZDB-GENE-980526-362 ctnnb1|OTTDARP00000037620 ctnnb1-001 LG_ CU929162.9 Danio rerio protein_coding KNOWN, 3558 bp
ATTTCAGTCTTTCAGCGTGCAGCCGTCTTCAGTGCTGCTT
GGATTTATATCTCTAAGTCATTGTTGTGTAAGGAAATAGC
TGTTGGTTCATTTACTGTAGATATCCAGTGGTACGGGATC
TAGTTTCCCTCAAGGCGGCAGGATATGGTATGGGTAGGAG
TTTTTATAATGGCTCGCGCACATATGGAGTGACGCCATCT
TTCCCTGTGTGCTGCTGCTGCGCGAGCGCGGAGTTCTCGC
GCACACATTCACTCTCAGCAGGAGCTGCCGCGCGCTGCGG
GTTGTTCTCTCACATTTTCTCAACGGATTGTCGCCATTAT
TCGCGTTTTACGTGCTGAAAACCGAAACAGGAATATACAG
CTTTTGACACAGATTAGTAAGCTGTGCCCGGCTGTGAGAA
AATCATGGCTACCCAGTCTGACTTGATGGAGCTGGAAATG
GCCATGGATCCGGATCGCAAGGCTGCAGTCAGCCATTGGC
AGCAACAGTCTTACCTGGACTCAGGAATCCACTCTGGGGC
CACAACTACTGCCCCGTCCCTGAGTGGCAAAGGCAACCCG
GAGGATGACGATGTGGATAATCAGGTGCTTTATGAGTGGG
AGCAGGGCTTCAACCAGTCCTTCAACCAAGAGCAAGTAGC
AGACATCGATGGTCAATACGCCATGACCAGAGCCCAGAGA
GTCCGGGCGGCCATGTTCCCGGAGACTCTCGATGAGGGCA
TGCAGATACCTTCCACACAGTTCGACTCTGCGCATCCCAC
CAATGTCCAGCGCCTGGCTGAGCCCTCGCAGATGCTCAAA
CATGCCGTGGTCAACCTCATCAACTACCAGGACGACGCAG
AGCTGGCCACTCGTGCCATTCCAGAGCTCACCAAACTACT
GAACGACGAGGATCAGGTGGTGGTTAATAAGGCAGCTGTG
ATGGTGCACCAGCTCTCCAAGAAAGAGGCCTCTCGTCACG
CCATCATGCGCTCCCCACAGATGGTATCGGCCATTGTGAG
GACCATGCAGAACACTAATGATGTAGAAACAGCCCGTTGC
ACCTCTGGCACCCTACACAATCTTTCCCACCACAGAGAAG
GACTGCTTGCCATCTTTAAATCAGGAGGCATCCCTGCCCT
CGTCAAAATGCTCGGCTCCCCTGTGGACTCTGTGCTGTTT
TACGCTATTACGACTCTACACAACCTGCTACTGCACCAAG
AAGGAGCCAAGATGGCTGTTCGACTGGCCGGAGGCCTGCA
GAAAATGGTGGCCTTGTTAAACAAAACAAACGTCAAATTC
CTCGCCATCACGACAGACTGCCTTCAGATTCTGGCATACG
GCAATCAGGAAAGCAAACTTATCATTCTGGCCAGCGGAGG
CCCACAGGCTTTGGTCAACATCATGAGGACATACACCTAT
GAGAAGCTGTTATGGACGACCAGTCGAGTGCTCAAGGTGT
TGTCAGTGTGCTCCAGTAACAAACCTGCCATTGTGGAGGC
TGGTGGCATGCAAGCCCTCGGCCTTCATCTCACAGACCCC
AGCCAGCGACTGGTACAGAACTGCTTGTGGACTTTGAGGA
ATCTGTCAGACGCCGCCACCAAACAGGAGGGCATGGAGGG
GCTCTTGGGCACCCTGGTGCAGTTGCTCGGGTCAGATGAC
ATCAACGTGGTGACGTGTGCTGCTGGAATCCTGTCCAACC
TGACCTGCAACAACTACAAAAACAAGATGATGGTGTGCCA
AGTGGGTGGCATCGAGGCCCTCGTGCGCACCGTTCTTCGT
GCCGGAGACAGAGAGGATATCACAGAGCCGGCTATCTGCG
CTCTCCGTCACCTCACATCCAGACACCAGGATGCAGAGAT
GGCCCAGAATGCAGTGCGGCTGCACTATGGACTGCCTGTA
GTAGTCAAACTGCTCCACCCTCCTTCACATTGGCCTCTCA
TTAAGGCTACAGTCGGGCTGATCCGCAACCTGGCACTGTG
CCCCGCCAACCATGCCCCGCTCCGAGAGCAGGGTGCCATT
CCCCGCCTGGTGCAGCTTCTAGTCCGGGCCCATCAGGACA
CTCAGAGACGCACCTCCATGGGTGGAACACAGCAGCAGTT
TGTGGAGGGTGTGCGTATGGAGGAGATTGTGGAGGGCTGC
ACTGGAGCTCTGCACATTCTAGCCAGAGACATTCACAACA
GAATCGTCATCAGAGGACTCAACACTATTCCACTCTTTGT
TCAGTTGCTGTATTCTCCTATCGAGAACATCCAGCGTGTG
GCTGCAGGAGTGCTGTGTGAACTGGCTCAGGATAAGGAGG
CGGCAGAAGCCATCGAGGCAGAAGGAGCCACTGCTCCACT
CACAGAGCTCCTGCACTCCAGAAACGAGGGAGTCGCCACG
TACGCTGCTGCAGTTCTGTTCCGCATGTCTGAGGATAAGC
CCCAGGACTACAAGAAGCGACTGTCTGTGGAGCTCACCAG
CTCTCTGTTCAGAACTGAGCCCATGACCTGGAACGAGACT
GGAGATCTAGGGCTGGATATCGGTGCACAGGGAGAGCCTC
TGGGCTACAGACAGGACGACCCAAGCTACCGCTCCTTCCA
TTCCGGAGGTTATGGGCAGGACGCCATGGGAATGGACCCC
ATGATGGAGCACGAGATGGCCGGGCACCACCCGGGCCCTG
ATTACCCCGTAGACGGCCTGCCTGACCTCGGCCACACCCA
GGACCTGATCGACGGCCTCCCGCCAGGCGACAGCAATCAG
CTGGCCTGGTTTGACACCGATCTGTAAATACAATGACTTT
TTAGCTGTATCGTCTGATCTGAATGAACCTGCATTGTGAT
TTTGGCCTGTAGAGTTGCTGAGCGGGCTCAAGAGAGAGTG
GGCTAGTTTCTCTGAAAGTGCCTGACACACTAATACAAGC
TGAGTTTCCTATGGGAACACGTGGAAGTAAAACGTTTGGT
TCTGATCCTAGCCGGTCAGAATTTTTGGTGTGATTGACAG
AAGAAAGCCCAAAAAAAAAAAGAAGCAAATCCTAAGATGG
AGTTTTCAACCTTAGCCTTGCCTGTACTTTTATTTTATTT
TTTCTTACTTTTTATTTTTCAAAGGATATCTGGGTCTGTA
ATGGTACTTATCTAGCTTGCTTTATGATACTCGTCTTTTT
ATTTTGCAGAACTTTGTATTCCTTTCGACTGTCTCTCTTT
CTCTCTCATAGTGTTGAGTTCTAGTGGTAATGATCCATCA
AGATTTTATCGACTTTATGGTGTAGAACACTAATTAATCA
GTTGAATTGTATTCTTATCAAATGTAACATTGTGTAGCTT
TTGTATAAAACCAAGAATTGGAGAAGTCCAAATATCAGCT
CTCTTGCTTTAATGAAATCACAAATGTTCCAAAGGGTTTG
CAATCAGTTGGGGCCAGTTTTGCTTTCATTTTTTTTTTAC
TTTTCAGTTCTCGTTTGATTTTACTTTACTGTCTTGATCT
ATTATGATTATTTTTTTTGATGGTAGCTTTAGAAAGGTTT
TTGAAAAGAACCCCTAATTATTGTAGCCTGCGATTTGTTG
GTTGGAGACTTGGCTAAATAAAATGGACTTTAAATTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations