Transcript

adamts9-201

ID
ZDB-TSCRIPT-100915-983
Name
adamts9-201
Previous Names
  • adamts9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047226 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047226|OTTDARG00000027703|ZDB-GENE-070814-6 adamts9|OTTDARP00000047882 adamts9-001 LG_none CT737428.5,BX000993.7 Danio rerio protein_coding KNOWN, 10402 bp
AAGAGTACGCCCAAGTAGGCTAAAGTAATCAGCAAACTGG
AGACCACCACAGTTGCATCGACCCCCTTTCTGGTATTATG
CATGCAAACCAAGAGCTCCGACCGAGCGCTTGTTTAGCGA
CATGGAAGTCACTTCTGTAAAGTAGAGGAGAAACGCTTTG
GATGCAGCAACCGTGCGGCGAAAGCCCGGCTTCAAGGGAC
AGCGGAATACTGTATTCGGGCTTGCTTGCATTCATTTTTT
CTAAACGTGGACAATCATGGTTTTGTTCTCCTGGGGAATT
AGTTTTTTAGTATTACTCTCTGATCTAATGAATGCACTAG
CTTCAACGGGGAGACTGCGAGGTTCAGAAAAAGCGAAATT
ACAGGAGTTTGGCGCGTATGAGATTGTAACTCCGGCCAGA
TTGAACGAAGTCGGTGAGCAACTGCCAACGGGCGTGCACT
TCAAGAGGAGAAAGCGGAGTACCGACCCAACAACCGCCAA
CATCTCTCATCATTGGACCTCGCCGCACGCCTATTATCAA
ATATCTGCCTTTGGGCAGGACTATTACCTTAACCTTACTC
TCGAGTCTGGATTTATTGCGCCAGTTTACACTGTCACGAT
ACTCGGAGCATCCAGTGAAGGTCATAATTCAGTGGAGGGG
GAGGAGGAGGAGGACACGGAGTATCAGCACTGCTTTTATA
AAGGACATGTGAACGCTGGGCAGGAGCACACTGCAGTAAT
CAGCCTCTGCTCCGGTTTGCTTGGCACTTTCAGGTCACCA
GAAGGGGAGTTTTTTGTGGAGCCCCTTCATAGCTACAATA
GTGAACATTATGAAGAAGAACACATCAAACCTCACGTCGT
GTACAGAAAAGATGCCTCAAAAAAGACTGTAGATGATTCC
GCTGCATGTGAAACTTCAGGACATACAGAGCCAAACCGCA
GACACAGGAACAGACTGAAGAGAAAGTCGCCCTCCAGCAT
GCTGTCCGACCTGGAGACTCTTAATTCCAGACTCTTCCCC
TTCTCAGAAAACAAGCACAACTCCGCTAATGAAAGCAGTG
ACTCCAAGCCACACCGGAGATCAAAGCGTTTCCTCTCCTA
CCCCCGTTTTGTTGAAGTCATGGTTGTGGCAGACAGCAAG
ATGGTGGAACATCATGGAAGCAACCTTCAGCACTACATTC
TTACCCTGATGTCCATCGTTTCCTCCATCTATAAGGACCC
CAGCATTGGAAACCTGATTAACATTGTTATTGTGAAGCTG
GTCATTATAAAGAATGAGCTGGATGGACCCACTATCTCCT
TCAATGCACAAGCCACTTTGAAAAACTTCTGCATATGGCA
GCAAAGTCAAAATCACCCTGATGACAACCATCCCTCACAT
CACGACACCGCCATCTTAATCACAAGGCAGGACATCTGTC
GAGCACGGGACAAATGTGACACTTTAGGTCTAGCTGAGCT
GGGTACAGTTTGTGATCCTTATAGAAGTTGCAGTATTAAT
GAGGATAATGGACTCAGTACTGCTTTCACCATCGCTCATG
AGCTCGGCCATGTGTTCAACATGCCTCACGATGACAGTAA
CAAATGCAAGGAGGATGGAGTCAAGAACCAGCAACATGTG
ATGGCCCCTACGCTCAATTATTACACTAATCCCTGGATGT
GGTCCAAATGCAGTCGGAAATACATCACAGAATTCCTCGA
CACAGGGTATGGTGAGTGTTTGCTTGATGAGCCGGTTTCT
AGGCCATACAGTTTGTCCCAGCAGCTGCCTGGACAGATAT
ACAGCGTCAATAAACAATGTGAGCTGATATTTGGGCCTGG
GACGCAGGTGTGCCCATATATGACACAATGCCGGAGGTTG
TGGTGCACCAGTCCTGATGGAGTCCAGCGGGGCTGTCGAA
CCCAACACATGCCATGGGCTGATGGCACAGACTGTGCTCC
AGGAAAGCATTGTAAACATGGCCTGTGCATCCATAAAGAG
CATGAATATGTTCCAGTTGAGGGTGCCTGGGGCGTTTGGA
GTCCCTTTGGCACGTGCTCAAGGACCTGTGGAGGGGGAAT
CAAGATCGCTGTCCGCGAATGTAACCGACCCGTGCCCAGA
AATGGGGGGAAGTATTGTGTTGGACGCAGGATGAAATTTC
GCTCCTGTAACTCTGAGCCATGCTCCAAGCAAAAGAAAGA
CTTCAGGGAGGAACAGTGTGCCAGCTTTGATGGACGGCAC
TTCAACATCAATGGTCTACCTCCAAATGTTCGCTGGGTGC
CAAAGTACAGCGGAATTCTGATGAAGGATCGCTGTAAGCT
ATTCTGTCGTGTTGCGGGCAGCACAGCTTACTACCAACTC
AGGGACAGAGTGACTGACGGCACGCAGTGTGGACCTGACA
CTAATGACATCTGCGTTCAAGGCCTGTGCAGGCAAGCAGG
ATGTGACCATGTGTTGAACTCCAAGGCCAGGAGAGATAAG
TGCGGGGTGTGCGGTGGGGATAACTCTTCATGCAAGCCTG
TGGCAGGAACGTTCAACATAGTGCATTATGGTTACAATGT
AGTGGTGAGAATTCCCAGTGGTGCTACAAATATAGATGTG
AGACAACACAGCTACTCAGGGAAAGCAGAGGACGATAACT
ACCTCGCCTTGTCCAACAGCCGTGGAGAATATTTACTCAA
TGGAGATTTTGTGGTCAGTATGTTTAAAAGGGAAGTCAGG
GTAGGGAATGCTGTTATTGAATACAGCGGCTCTGACCATG
TCGTGGAGAGAATCAACTGCACTGACCGCATTGAAGAGGA
GATTATAATCCAGGTGCTATCCGTAGGAAACCTCTACAAC
CCTGATGTCAGGTATTCTTACAACATTCCCATAGAGGACA
AACCTCAGCATTTTTTCTGGGATGCGTACGGCCCGTGGCA
GGATTGCAGTCTTTTGTGCCAAGGAGAGCGCAAGAAGAAG
ATCTTGTGCAATCGTGAATCGGATCGAGTGGTGGTTTCTG
ATCAGCGGTGCCACGGTTTACCTAAACCAGCTGCGATCAC
TGAGTCATGCAACACAGACTGTGAACTCGGGTGGCACATC
GCTCGCAAAAGTGAGTGCACAGCGGCATGTGGTGTGGGCT
ACCGGTCTTTGGATATTTACTGCACCAAACAGAGCAGATT
GGATGGGAAAACCCAGAAGGTGGATGAGCGGTACTGCAGC
AGCCAACATAAACCCAATGACAAGGAGGTCTGCCATGGAG
ACTGCAACCCTGGTGGATGGGAGTACTCCTCCTGGTCTGA
GTGTTCCAGGAGCTGTGGAGGAGGAACACGTCGCAGGAAT
GCAATATGTGGAAAGTCTGACGAAAGAGATGACGATAGCA
AGTGCAACCCACAAGAAAAGCTCACAGCTCAGCCCTGTAA
TGAGTTCCTGTGTCCTCAGTGGAAAACTGGAGACTGGTCT
GAGTGTTTGGTAACATGTGGCAAAGGCTATAAACACCGTC
AGACTTGGTGTCAGTTTGGAGAGGAGCGTTTGGATGTCCG
TTTCTGTGACTCATCCAAACCCGAGTCGGTGCAGGCCTGC
CAACAGCAAGAATGTGCGTCTTGGCAGGTGGGACCCTGGG
GACAGTGTACCACCACATGCGGACCGGGATATCAGATGAG
AGCTGTGAAGTGTGTGGTTGGCTCATATGGCTCTGTTATG
GATGACACTGAATGTAATGCAGCAACTCGTCCAACAGACA
CTCAGGACTGTGAACTCTCTCAGTGCCCCGTGACTCATCC
CGTGGCCCCAGAGCCCAAAGTGATGCCACATCCTGGCCAT
AAAACGCAGTGGCGCTTTGGATCATGGACACAGTGCAGCG
CCACCTGTGGAAAAGGCACTCGGATGCGTTATGTAAGTTG
CCGTGATCAGCAGGGTGGAGTAGCAGAGGAATCAGCCTGT
GCTCATCTGCCAAAACCTCCTGCTAGTGAGGTTTGCTCCA
TAGTGGCGTGTGGACAGTGGAAGGTTCTGGAATGGACTGC
GTGCTCTGTATCCTGTGGTCAGGGTACGACTACACGGCAA
GTAGTGTGTATGAACATCAGCGATCAGGTTGTGGAACTGA
GTGAGTGTGACCTAGATGACAAACCCGCGGCAGAGCAGGA
GTGTGCCATGCCCCAGTGTCCGTCCCGCTCCAGCGACCAC
GGGGGCTTTTCACCCAACCCCGATTTTCGGAAAAAAACAG
CTCTTCCAGGACGAACTGACCGCAACAGAGCTGGCAGACT
CCAGGCTCAGCAGTGGAGGACGGGACCATGGGGGGCGTGT
TCGAGTACCTGTGCCGGAGGCTTCCAGAGGCGCGTGGTGG
TGTGTCAGGATGAGAACGGATATCCGGCCATCAGCTGTGA
TGAGAGCATTCAGCCCATTGAACAGCGCTCTTGTGAGTCT
GGCTCCTGCCCGCAGTGGTTCTACGGCAGCTGGAGTGAGT
GTTCAAAATCCTGTGGAGGAGGGATAAAGACCCGGCTGGT
CGCCTGTCAGCGTCCCAACGGGGAGCGTTTTAACGATCTG
AGCTGTGAAATTCTTGACAAACCACCCGACCGAGAACAGT
GCAATACTCAGTCCTGTTCTATTAACCCTCACTGGAGCAC
AGACCAATGGAGCTTGGTACGCTCATAACTACATTAACCC
TTTTCCCCTTCATAAGTTCTCATTCTCACAACAGGCTGAG
GTTTCTTTACACCCAACAAATATCCAAGAAAACAAATGGA
AACTCTTTAACGGTTTGATCTTTTGCTGCTTTGAGGTTGC
ACTTAAAGACCTACCAAAACATGCAGTTTAATATTGATTG
AAAGTTTTATTTCCTAACTGAAAAAGTGAGCATCTCTTTG
GTCGACTTGTTTTTTTTTCCCAATGCAGCTGTACTTTACA
TTCATTCTAAGGATTGTGACGGTATTTGTGGTGGTTTGTG
TTCAAAATATAGTACAGTTGTATTTAGTATTTACAATGCA
GGCAGTTTACTTTGGTATAATGTTTTATTTTTGTTTCTGT
TGCTCTTTAATATTGATTTTTTAACCATACCTCACGTGAA
ACTCAGCTAGCCATTGACCTTTTTTTCCACTTTATGATGG
TGCTTTTTCAGTACAAGGGAGACTTTGTGAAAATCTGTTT
ATAGTTGCTATATTTTTGTATATTTAAGGTAACTGACTGA
AGTAACTACAAAAGTAATTGTGACGTAAATCAAATGTAGC
TTTCGTTCATTTTTATGTCTGTTGATTTGTTCTGATAGCC
TTTTGTATTCTTTTTTCAAAATCAGTATTATTACTTTTGT
TTTGTGTATAAATCTAGTTTTTTTTTTGTTTTTGTTTATG
TTTTTTTTTTTAAGTTTGTTTTGTTGGCCAGTTACTTGTG
TCTACCTCATTCTCAATGAAGAGCCCCATAACCGTTCTTT
CTACTTTATATTAGTGGATGTGGATACAAAATATTAACAT
CCTTAAATGTATTGCTTAAAGTGTTAGCGCAGCCAGAAAT
TAAAATTCTGTTATTTATTACTCAGCTTTATGTCATTTCA
ACCCCCTGAGACTTTCGTTCATCTTCACTACACTAATGAA
GATATTTTAGATGAAATCCTAGAGCTCTTTCATCCTGTAT
AGCCAGCTGTAGATGTTCATAAAACTGTCAACACATTCCA
CTTCAGTGGTTCGACTTTATTTATGCAAAGGTCCAAAAAC
ACTTTGTAAATCTGTAAAAATCTGTAAATACAACTTTACC
AATGTTTTCCACATCAGATCAGGAAGCATATTTACTATGG
GCAATACTACTGTGTGCTTGCTTGTTTGCTTTGCGGACTC
TTATGGCAAATTTGTCATACTTTATTTACATACTTCAATT
ATATTTACAGCTTTTTTTTTTATGCACAAAAATGATGTGG
ATCTGGATTTGGAGCATATGATTACAACTGAACCACTGAA
TTCACATTAAATGTTTTTGGTCTGGACTTGGAACATCTCA
GGACAGTTGCTGTCTATGGAGGGTGATGGAGCTTTTATGC
TGTATTCACAACAGATGCGGTACGCGTGGTAAAATCTTGT
ATTCGCTGGGTAAATAGACACGTGAACATTTTGAGTTTAC
TTCATACACGCATCAAATCTGCTTCATTAGCGTGTCATGG
GTGGCCTTCTGTCTGCGCGGTGATTCTAGGTTCATTGCTA
AATAGCGAACATGAATTTTATAGAGAGAGAATAGCTGCGT
TTATGTGTTTTAAGAAGACTGAAAAACAGTGTCGATTCAT
TTGAAGCCGTGCGTGAGTCCACTTGGTCCATTCTGGGGTG
CACAGCTCTGTGAGCTCATCAACTCCTCCAGAAACTTAAC
CTAGATAATGGAAGCTTTCAGCAGTGCTTCCAACTGAGCC
GAGCCCAGTTTAATGAACAGTTGTCTGGTGTCGGTAGGAG
AATTTTACCCCGGGACACCAACAACAGGCGCTATGTCATA
ATCACGCCCCTGCAAGAGAAACTCCTGATTGGTTAATGCG
GCACGAATGTCCGCTGAAGTTCAGATTTTCCAACTCGAGC
CATTCGCGCAAAACGCATAATTTGCGCCCCCTCATTCACG
CGTATCGGATCGATTCGCGTTTTTGCATGTACTTAACATG
TAAATCACTCACGCTTAACGCATCTTCTGTGTCTGGTGTG
AACACAGCATTAGATTTAAGCTAAACTCCAATTTTAATGT
TGTTCTGAGGCTGAATGAAGGTCTCTGGGGAATTGTAATA
ACATGGGAGTGAGTAACTGATAACATATTTTTTAGTTTTG
GGTAAACTAATCCTTTAATTTGTTCTCTAATATCTCATGG
ATATGGCAGTAGATGATGACCAAATTTAAGAGACACATAC
AGTGTTGAAAAAAATGTTTTCCACCATACACAATATGGTT
AAAATTGTTATTTAATGTGCATTAAAAAATAATAAATTAA
AGTTGGAATTTTAAAGGGACAGTTCCCACCAAAATGAAAG
TTTGCTGTTAATCTTATAACATGCACTCTTAAAAATAATA
ATAATTATATATATTTATTTATATAAATAAAATAATCAGG
GCTTGACATTAACTTTTTTGATCAACAGCCACTTTAATCC
CTTGCCGTTTTCACTGGCCACAATATTATTGTTGGGAAAC
TATATTTTATTCACATGAATGTGACTTTGACATGCTAAAA
TTACTCGATTTTGGCTTTGCGTTATGTCCACATGCCTCCT
CATTCATTTCATTGTTGTTTTTAATAATGAGCAAATGTGT
CATGGTTTCATAGTATTAGTTAGTTTTTATTTCACATAAT
TTTCAGAGCTCAGAATGAAGGATTTACCAAAATTATCTCT
GACCACACCGAACATTAACAATTAATTATTTCTTAGTCAC
AAATTTTAAATGTGTCAAAACAAGCAAAATATAGCTGTAT
AATTTTTATTGAACCAAACATATGCAAAGTGATTTGTCCT
GGCTAAAGGCCTCTCAGATCACCAGTTAACTACACATAAA
TGGAGAGTTAATCTCCCATTAAAGCAATGTTATTGAACAC
AATGATGATTAAAGCATATTAACGCAAAAGAAAGCAGGTA
TAAAAAAAAAACATACCGTGTGATAATGAAAGGATGATCA
CACACACAAACGCTTAACATTAGACTTATAAATATTCTGT
TCAAAGAACAGTTACAGCGAAAGCAACTGGTGCTGCTTAC
AAAAAGACAAATCTGGAGCTCTTGAAAGCAGCAAGACAGT
GGGTGCATGTTCATCACATTTTGTCTATTCTATTTGAAAA
AGACCCGTTCACATCAGTTGTTTCTAGACACAGTTGCTTC
ACGCAAGGAAACGGGAGCGCGCACATGTTTTAAGCAGTCG
CGCTCATCACCTCAGCTGATCATCCTCTCATTCGGTATTC
ACTTGCTTTCAAAAATAACACAATTATTTTTGTCTTTCGT
GTTGCTTCTCAATTCTAAGATCACCTTTGCATGCATATTA
GACCATTCTTATTGTCGAACCCTGCTTTTAAGAATTATTA
TCAGGGAAAATTATTTTCAACCAGCCAAAGGGGCTAGTGG
GAGAGTCTGTCTAACCTGCCACCGCTGAAATCTACTTGAA
TTTGTAGGGTTGGGGGGTGTTAATGTCAAGCCCTGATAAT
AAATATATATATATATATTTAAAACATGTTCATTTTTATT
TGATGTTGTCTGTATACGCGTATAAATATACAGTACGTAT
GAACCACTGACTTCTAATTTTATATTTGACAAAGTACCAC
AGTTTCAGATTAATATCTAATTCGACATTAAACAGAGTTA
TTAAATTAACATCAGACTTTCTTTTTTTGTGATAAAAAAT
TAATCAAATTAAATCAAATTAAATCAACAAAATCCCAATC
CAGTAGATACTTTTCAGGGGGTGTACTTACTTTTTCACAA
CACTGTATCATTGCTAACCTGTATTTTGTCCAAAGACACC
ATGGTGCTATAGTGTCTGAGGAGCAATTCCCTTTCATGAC
ATGGTCTGTTACCGTAACCAGACTGAAAATGATGTGCTCT
CAATCAAATGGCAGTATTGATAAAGGTGCGCATGAGCATT
TCTGTATATTATTGTATGTATTTGTATTTATTACAACTGC
CATACACGTGTCATTATATTTTCAAACAGTCAAATTAAAC
AACTGCAAGGTGTTATTTTTAAAAAGTAGGCTATTATGCT
GTAATTAATGCTTGATTTGTAAATCTAGAGACTTTTTGAA
TGTTTTATATTATTCTAAAGATGTTATATATATATGTATA
AGCATACATGTTCAATATGCAATGAATGAAAGAAGGTACA
AAATCACTAAGCATGATATCTGTTGTCTCAGATTTCTTGT
GATTTTTATCCTGCTGCTCATCTAAACGGGATGTCTATAT
TACCTGTTTTAATGATCTCGGATGGATTTTTTTGGTGCTC
ACACTTCAATACCTACAGAAAAAAAGAAGTCTGTACGGCT
GTCAATTTCCTTTGGTTCAGCACAGGATATTAAGCAGCCC
TGATGGCAGTGATACGGTCACAGTCAAGCGAGTGAACATG
CATCAAAATAACAATGACAAGGGCACAAGGGGTCAAGGAC
GGCCTTTGATCTCTGGGAAGCTCTTTTCTGGCCTCATCTA
ATCAGAATGGACGCATTTCTCAGAAAGAGGTTTAATCTTA
TGGGAAAAATGAATGGAAAGAATAAGGGCCCCTATGGAGC
ACGGAGGCCTCCTCGGCATGGATATCTGTGTGTGGTTTCA
TTCTTGGGAGTTGGAATGTAGTGAGGCATGTTGCCGGGTT
TGGACTGATCATTCAGGACGATGATTTCAAAGAAAAACAA
GGGCACACTTATTTGTTTTGACTGCATTGGAATGTCATGA
ATTGGATTATTTGGTTTGGGTCGCAAATATACAAAAGTCT
TGCTCATTTTTGAACCAAAAAAGCCTACATCGTTTGTATT
TTATTTTTCTGATGTCGGTTTAAGAGAAATTTGCTTAAAC
AGTCCACTCTGGGAAATGAGTTCAAGCTTGTGTGTTTCGA
AATCGTGGGTGGTTTTTGCATGAAGGGAATTTTGAAGTGA
ATTCCCCTGCTTTGAGTGTAAATGTTGGTAATTTGCGCTC
ATTAAATCAGTGGAGCGTTTGTTTAACAAGGCACATCAAC
TGAACAGCAGTGTTGCAGTTTTTCATACCTTAAAGGGATA
GTGCTCCCAAAAACTGAAAATTCAGCCATTATTTACTCAT
GCTTGCTCCAAACATGCTTGACTTTCTTCTGTTGAGCAAG
ATATTTTTAAAGAAACCAGGAAACATCTTCCATTAGGTGT
TTTTATTCTGTCAGATTTCTTCATATATATTCATTAGTGT
TCATCAGAAGGTTTGAAACCAGTTGAGTAAATAGTGAATA
CATTTTCATTTTTGGGTAAACTATCCCTTTAATCATCACT
GAAATAAACGTCCTGCTATATCTAAATAATTTATAGGTCA
TTTTCAGATATTTTACTCATATGTAAACATTTAAAACAGT
AATTCTAAGTGTTTTCAATGAGAAATTAGCATTAAGATTT
AAATACAGTAAACATATTCAGTTTATTTTCTGCACCAACT
CAAAAACATTGATCTTTCATCACACGTGTAATAGCACAGA
ATCTCTCAAAGAAAACAGAAGCCTTTTCATGGTTGCATAA
ACACACACTCGCTGTAGAATTCTGAGTGAGCAAGTGTATG
ATTTATTATGAATCAACATCGAGGCCTTTGGATGAATTAT
TAAAGTGGATCGTTATGACAGTGGTACATGGAGGTCTTGC
TTTAAAGATAAATGTGTATTTTTATATGAAGTTTTTTTTT
CTGTTGTGTTGTTTTGCTGCCTATGTTGATATTGAATTGT
GTATAAAATGTATTCAGTTGAACCAATTGTATATATTTTG
GTACTGTAAATATTTATAAAAGCAAATATATATTTGAATG
TT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations