Transcript

tubb2b-201

ID
ZDB-TSCRIPT-100915-89
Name
tubb2b-201
Previous Names
  • tubb2b-001
  • ch73-112o19.2_2-001
  • si:ch73-112o19.2_2-001
  • zgc:123194-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044895 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044895|OTTDARG00000032654|ZDB-GENE-030131-722 tubb2b|OTTDARP00000035518 CH73-112O19.3-001 LG_ CU984584.10 Danio rerio protein_coding NOVEL, 1568 bp
TTATATGGGGGAAGTGTCTACTCCCAGCCAGTTGAAGAAA
GGAAAAGGTTCGCTGCTTTCTCAAATCCAAATCACTCGAG
CTAAAATGAGGGAAATCGTGCATCTTCAAGCTGGACAATG
CGGAAACCAGATTGGAGCCAAGTTCTGGGAGGTGATCAGT
GACGAGCATGGTATTGATCCCACTGGAACATATCATGGAG
ACAGCGACCTTCAACTCGACAGAATCAATGTCTATTACAA
CGAGGCATCAGGAGGTAAATATGTGCCCCGTGCTGTGTTG
GTGGATCTGGAGCCTGGTACTATGGACTCTGTGAGGTCCG
GACCCTTCGGTCAGGTTTTCAGACCAGATAACTTTGTTTT
TGGTCAGAGTGGTGCTGGAAACAACTGGGCTAAAGGCCAC
TACACAGAGGGAGCAGAGCTGGTGGACTCTGTCCTGGATG
TGGTTCGCAAAGAGGCAGAGAGCTGCGATTGCCTGCAGGG
CTTCCAGCTCACCCACTCCCTGGGTGGAGGAACGGGCTCT
GGTATGGGCACCCTCCTCATTAGCAAGATCCGTGAGGAGT
ATCCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTC
ACCCAAAGTGTCTGACACTGTGGTGGAGCCCTACAACGCC
ACATTGTCGGTTCACCAGCTGGTTGAAAACACAGACGAGA
CCTACTGCATTGACAACGAGGCTCTTTATGACATCTGCTT
CCGCACACTCAAACTCACCACACCGTCATACGGTGATCTC
AACCATCTCGTATCTGCCACCATGAGTGGTGTGACCACCT
GCCTCAGGTTCCCCGGCCAGCTCAATGCCGATCTCCGCAA
ACTGGCCGTCAACATGGTGCCCTTCCCCCGTCTCCACTTC
TTCATGCCCGGCTTCGCTCCTCTGACCAGCAGGGGGAGCC
AGCAGTACCGCTCTCTAACCGTACCCGAGCTCACACAGCA
GATGTTTGATGCTAAAAACATGATGGCTGCGTGCGACCCG
CGTCACGGCCGCTACCTCACAGTCGCCGCCATCTTCCGTG
GCCGCATGTCTATGAAGGAGGTCGACGAGCAGATGCTCAA
TGTTCAAAACAAGAACAGCAGCTACTTTGTGGAATGGATC
CCAAATAACGTCAAGACCGCCGTTTGCGACATCCCGCCTC
GTGGTCTGAAAATGGCCGCCACCTTCATCGGAAACAGCAC
TGCCATCCAGGAGCTCTTCAAGCGCATCTCCGAGCAGTTC
ACGGCTATGTTCAGGCGCAAGGCTTTCCTGCATTGGTACA
CAGGCGAAGGTATGGATGAGATGGAGTTCACCGAGGCAGA
GAGCAACATGAACGACCTGGTGTCTGAGTACCAGCAGTAC
CAGGACGCCACCGCCGAGGAGGAGGGCGAGTTTGAGGAGG
AGGGAGAGGAAGAGCTGGCTTAAATCGCATTAATATACGT
GTCGTTTTCCAGGCTGTATCATTTTGCTCATGTAAAAGGA
AAATAAACCTTCCAAAGTCCTGTTTTTTTGTTCTATTCCT
CCTCATGTTTGTACAGATGTCAATAAAAGGCTTTTTCTTC
TGTTAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations