header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-157
Transcript Name: rtn4ip1-201
Previous Name: rtn4ip1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046005 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046005|OTTDARG00000032861|ZDB-GENE-040426-1314 rtn4ip1|OTTDARP00000036300 rtn4ip1-001 LG_ FP015823.9 Danio rerio protein_coding KNOWN, 1370 bp
CTGTTCTCGAGCGTGTTATTCAACAGTTATAACATTTATT
TCTGACCAATGACGGGTTTGTGATACTATAAGCGGGATCC
TCTGGATTATCTTTTTAAAGTTTGATCAACCATGTTGATG
TGTAGACGGTGGTTGGTGTGCTCGCTGAGATGTCATTACA
GGAGCTTCAGTTTCTCAGCCGCTCGCAGGACTGTAATGCC
CGCATGGGTCATTGATAAATACGGGAAAAACGATGTGTTG
AGGTTCACCAAGAACGCGGCGCTTCCGATCATCCACTATC
CTAATGAAGTGGTGGTAAAGGTGCACGCTGCGGGTCTCAA
CCCAATTGACATCAGTATGAGGGGTGGCTATGGAGCAGCT
ACTATGGCCATGAAGCGTGACCCACTGAACATCAGCCAAT
CAGGTGGTGAATTTCCTCTCATTCTGGGTCGAGATGTATC
CGGAGAGATCATGGAATGTGGGCTGGATGTGAAGTACTTT
AAACCAGGAGATCAGGTGTGGGCCGCTATTCCTCCATGGA
AGCAGGGCAGTCTGGCAGAGTTTGTAGTGGTCAGTGGCAA
TGAGGTTTCACATAAGCCTAAATCACTGAGGCATGATGAA
GCCGCATCCATCCCGTATGTGGCTGCAACAGCCTGGTCTG
CCATCGTCAACACCGGTGGCCTCAACAAAGATAACTCTGT
AAAAAAACGTGTTCTTATTCTGGGAGGATCAGGAGGAGTG
GGAACTTTTGCAATACAGATGGTAAAGGCCTGGGGTGCAC
ATGTGACTGTAACATGTTCCCAGAATGCTGAGCGGCTGGT
GAGAGACCTAGGTGCTGATGATGTCGTGGACTACACTGCT
GGGCCAGTTGAAAAGCAGCTAAAGAATTTTGAAAAGTTCG
ATTTGATTTTAGACAGCATTGGGGGTGAAACTGAAAAATG
GGCCCTAGATCTCCTGAAACCCTGGAGTGGTGCTAAATTT
GTGACCCTGATAACACCTTTCCTGCAAAACACAGACCGAC
TGGGCCTTGCGGATGGAATGATGCAGTCTGCAGTCACTGT
AGGATGCAAAGTGGTGAAGAACCTCAGGAAAGGAGTGCAT
TATCGCTGGGGTTTCTTTGCTCCAAGCGGCTCTGCGCTGG
ACGAGGTTAGCGAAATGGTTGACGCTGGAAAGGTCCGTCC
AGTAGTGGAGGAAGTGTTTTCATTTGCTCAGGTGCCAGAA
GCCTTTCAGAAAGTAGAGCAGGGTCATGCTCGAGGAAAAA
CTGTCGTCTCTATCATGGAGGACCAGAAAGAGTAACTATT
GCAGTCAAGAGAATACTGTTAAACATGGACAATGGGATAT
GCGATTTTTTTTTCCAGTCTGTTGAATTAAATGCATTTCT
GTAATGGCAA

rtn4ip1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rtn4ip1-201 1370
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rtn4ip1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000046005 (1),  Ensembl_Trans:ENSDART00000040032 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC053171 (1) 1412 bp
CITATIONS (2)