Transcript

tll1-201

ID
ZDB-TSCRIPT-100915-1517
Name
tll1-201
Previous Names
  • tll1-001
  • ottdart00000047341
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047341 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047341|OTTDARG00000033631|ZDB-GENE-041020-1 tll1|OTTDARP00000037197 tll1-001 LG_none CT573182.6,BX119983.5 Danio rerio protein_coding KNOWN, 4633 bp
CGTTAATCTCTAGGGAAATGGGCACGTTTGGAATAAGCGG
TACCAGTCAGCTAGCGCACTCTAATATTCCAGTGGCTGTA
GAAAAAGTGTTTCCAGAGAGAGAGAGAGAAGAGAGAGGGA
GGGAGAGAGAGGGAATATGAGGGCAGTACTCAGGATGAGC
CTGCGCTTTGAGGCTGTAAAACACTAGACCCTGAGGGCAT
TCTCTGTCTGAGCTGTGCCTCTTCAGGAAAACTGACTGCG
CAAGAGAAAGGAAGAGTGAGCTGGTATCCTCTGTAGTTGT
AGGTTCATATTGATGCATTTGGCGTCCAGCTGAGATGCCG
CGACGCTGACGGTCCTGCCCCGTCTGTCGAACCGGACCAA
TGATGATAATGAAGGCGATGATGTCCACACGGCGCGTGTA
GCGCTAAATTCCACACTGCCGGACTCCTACCAGACACTCC
TCTCTGACCCACGCTCGTTCACACCTCAGATGGACTACCT
TTACTCTGCACTCACCAGTAAAATGAATTGGATCGCACTC
CTGCTGGCCGGCTTGACTTTTTGTTGCAAAGTGTCCGTGC
ACAGCTGTTTAGATTACGATGACAGTTATGATTATTACGA
GGAGGAGAAAACAGAGACAATAGACTACAAGGATCCCTGC
AAAGCAGCTGTATTTTGGGGAGACATTGCCTTGGATGATG
AGGACTTGAAAATGTTTCACATCGATGGGACGATAGACCT
TAAGCAACAAACACATGGGAGGCAAGGACACACATCTGGA
GGTCTAGGAGAACATGTGCCCACTAAGAAGAGGGGTTCCT
TATATCTGCTGCTAGACAGAATACGACGGTTAGGTTTTGA
GTCGTGGCCAGTAAACAGCAGTAAAGATGTGTCAAGCATA
AAGACTGGAATAAGGAGAGTAAACAGCGCCAGAAATGTAA
AGTCTCGAGTCCCACGTGCTGCTACATCCCGAGCTGAGAA
GATCTGGCCTGGAGGAGTCATCCCTTACGTCATAGGAGGC
AACTTCACCGGAAGTCAGAGGGCCATGTTAAAGCAAGCAA
TGAGACACTGGGAGAAACAGACGTGCGTGACTTTCATAGA
GAAGACTGATGAGGAGAGCTACATTGTCTTCACGTACAGA
CCTTGCGGGTGTTGCTCTTATGTCGGTCGCCGTGGAAATG
GTCCCCAGGCAATATCTATAGGGAAAAACTGTGACAAGTT
TGGCATTGTGGTTCATGAACTTGGGCATGTGATCGGCTTT
TGGCATGAACACACACGACCTGACCGTGACGATCATGTGA
CCATCATCCGGGACAACATCCAGCCAGGTCAGGAGTATAA
CTTCATCAAGATGGAACCAGGGGATGTCAACTCTCTTGGT
GAGCCGTATGATTTTGACAGCATCATGCATTATGCCAGAA
ACACTTTCTCCAGAGGAATGTTTTTGGACACGATTCTTCC
CTCTCGTGACGAGAATGGCGTCAGGCCTGCTATTGGTCAG
AGAACCAGGCTCAGTAAAGGGGATATATCGCAAGCCAAGA
AGCTGTACAGATGCCCAGCATGTGGCGAAACACTACAGGA
CTCAGTGGGGAATTTCTCATCTCCAGGATATCCTAATGGA
TACCCATCATATACACACTGTGTATGGAGGATCTCTGTCA
CACCTGGGGAGAAGATAGTGTTAAACTTCACCACTATGGA
CCTCTACAAGAGCAGCCTGTGCTGGTATGACTACATTGAG
GTTCGTGACGGATACTGGAGAAAAGCGCCATTGCTGGGCC
GGTTCTGCGGTGATAAAATTCCAGAAGTTCTGGTCTCTAC
AGACAGTCGGATGTGGATTGAGTTTCGAAGCAGCAGCAAC
TGGGTTGGAAAGGGATTTGCAGCAGTCTATGAAGCAATAT
GTGGAGGGGAGATCAGTAAGGACTCTGGACAGATTCAGTC
TCCAAACTATCCAGATGACTATCGCCCATCTAAGGAGTGT
GTGTGGAGGATCACAGTGTCTGAGGGCTACAGCGTGGGCT
TAAGCTTTCAGGTTTTTGAGATCGAGAGGCATGACAGCTG
TGCATACGACTATTTGGAGGTTAGAGATGGATTGTCAGAG
AACAGCCCTCTGATTGGTCGATTCTGCGGCTATGATAAAC
CTGAAGATATTCGTTCTACCTCTAACAACCTCTGGATGAA
ATTTGTCTCTGATGGGACTGTTAATAAAGCAGGCTTTGCT
GCAAACTTCTTCAAAGAGGAAGACGAGTGTCTGAAGCCAG
ATAATGGAGGCTGTGAACAGAGATGTGTGAACACATTAGG
AAGCTTCAAATGTGCATGTGATCCTGGATATGAACTGGCT
CCTGACAAGAAGAGCTGTGAAGCTGCGTGTGGCGGTTTGT
TGACTAAGTTGAATGGCACAATTACCACCCCAGGCTGGCC
TAAGGAATACCCTCCCAACAAAAACTGTGTGTGGCAAGTA
GTGGCCCCGACTCAGTACCGTATATCCATGCAGTTTGAAG
CCTTTGAGCTGGAGGGAAATGAGGTGTGCAAGTATGACTA
CGTCGAGGTGCGGAGCGGCTTGTCATCTGACTCAAAGCTT
CATGGGAAATACTGCGGCACGGAAGTTCCTGAGGTCATCA
CCTCCCAGTACAACAACATGCGAATCGAGTTCAAATCAGA
CAACACGGTCTCCAAGAAAGGCTTCAAAGCTCATTTTTTC
TCCGATAAAGACGAATGTTCAAAGGATAACGGTGGATGCC
AGCATGAGTGCATCAACACTATTGGCAGCTATGTGTGCCA
GTGCCGCAACGGCTTCATCCTACATGAGAACAAACATGAC
TGCAAGGAAGCTGAGTGTGAGCACAAAATCCACAGCACGA
CTGGAACCATCAGCAGTCCAAACTGGCCTGACAAATACCC
CAGCAGAAAGGAGTGCACGTGGGACATCACCGCAACCCCT
GGTCACCGGGTCAAAATTTCTTTTAATGAATTTGAGATTG
AGCAGCACCAGGAATGCGCATATGATCACCTGGAGGCCTT
TGACGGCGATTCAGACAAGACTCCTATACTGAGTCGCCTG
TGTGGCAATAAGATTCCCGAACCACTCATTTCCACTGGCA
ACAAGATGTATCTGCGTTTCATCTCCGATGCCTCAGTTCA
ACGGAAAGGCTTTCAGGCCACTCATTCCACCGAATGTGGC
GGAAGGCTGAAAGCAGAAGCACGACAGAAGAACCTGTATT
CTCATGCTCAGTTTGGAGATAATAACTACCCCGGACACAC
CGACTGCGAGTGGCTCATAGTGGCAGAGTCGGGTTATGGC
ATCGAACTCACCTTCACCACCTTTGAGGTAGAAGAAGAGG
CAGACTGTGGGTACGACTACATCGAACTTTACGATGGTTA
CGACACTGGAGCGCACAAAATCGGACGCTTCTGTGGATCT
GGGCCTCGTGAGGAGCTTTACTCTGCTGGCGATGCCGTGT
TGATCCATTTTCACTCTGACGACACCATCAGTAAGAAAGG
CTTTCACATCCGCTACACTAGCACAAAGTTTCAGGAGGCG
CTACACACACGCAAGTAACATTTGAGAGACTGAAGACAGG
GATAAAATGAGGAGAAAAAGACTCCAGCAAACTATTGCAA
TTGATTCATTTCAATCAAAGACCCTGCCGTTATGTGTTTT
CTGCATTGGATTTGCCTCTATGTTCAGCCACTATGGAAGT
GCTGTCATATTGACCCTAAACACCAATCAGCTGCTCTTAT
GTGTGGGATTGCTCCGCCCACTGGAGTGGTGTCTTGCGCT
CTCTGACTGGAGCAGTGCAGTGAAAACACACACACACAAT
CACACACAAAACTTTCTTGTTGGCTCTCCATTCTTCAGAC
ATAGAGTTGCACACTGAAACTAAGAGACACTGATAATAAG
ACATTTAAGTAACTGCTATTGAACGTGTGTGTGTGTATGT
GTGTGTGTTGCTCCGGACAGCATGGACAGTTTGGCTGCTG
ACGCCACACCACACTGTACCTCAGCTAAAAATGTGTGTGT
GTATTTGGATGTGTGTGATTGAGAGAAAAACAGAAAGAGA
GAGAGAGAGGCCTTCAAATACCAGCCTGAACTCATTCAAA
TGTTTTTTTTTAATTGTGGTTGTACAATTCTTCTGTTATT
GTTCTGTTAGCTTTACGGCAAAACCCATTTTCTCTCCATC
AAAAGTGCAAAAGTAAATATGTAGCCCTATTTAACAATAA
GCTTCCTTACATGTATGTAGCCCATTGTTTATGTCAGCGG
AGACAGACATCATTTGTCAGTGAACTATTAAGCTGGAGGG
TCTCATTCACTAAGTATCTGCATGCATCAACTGGTGAGGG
AAATTTCCAACCCATTCTGAAAATGTACCTTTATATACAT
TTCTGGAGAGCGCCAAATACGTCCCAGGAGCTACGTTTTT
GTCAGTTTTTGTTTTTGCGAATCCACCAGAGGCTGCTGTG
TATGCTTTTTGAGATCTTAAATTTCTCTCACCATTGCCAT
TCACACCTGCTGTTCTCTTGTAAATCCACCAGAGCCCGCT
GTTGACTGACTTTCTGGCTGACCAATCAACTTGACCCACC
CTCCTCCTTTCCTAAACCTAACCAATAGTATTTTAAAAAG
CACAGATTGACCTGCCCACCCACTTCCCTAAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations