ZFIN ID: ZDB-TSCRIPT-100915-1099
Transcript Name: pou5f3-201
Previous Names: pou5f1-001, pou5f3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044767 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044767|OTTDARG00000032106|ZDB-GENE-980526-485 pou5f3|OTTDARP00000035418 pou5f1-001 LG_ FP089537.7 Danio rerio protein_coding KNOWN, 2476 bp
AGAGCTGAGATTGGGAAGAGTTGGAGGTGGTGAATTATTG
GCCCATTCTGATTGATGGCCGCCACACAAGGACTGCGCAC
ATTTCCACACAGGCTGATACTGAGACGCGCAATCTGAGTT
TAGTCTGTTTGGATCATCCTGGGATGGAGCAACTGATCGA
CGTTTATTGATTATCAAACCAGCAGTCTTTACGCTTTCTT
GTTTGAAATCTCAACAACCTTTTTAGCGGAAAGATGACGG
AGAGAGCGCAGAGCCCAACAGCAGCAGACTGCAGACCCTA
TGAGGTCAACAGGGCCATGTATCCTCAAGCCGCGGGCCTG
GATGGACTTGGCGGAGCGTCCTTGCAGTTTGCGCACGGTA
TGCTTCAGGATCCAAGTCTGATTTTTAACAAGGCCCATTT
CAACGGAATCACCCCCGCGACAGCCCAGACCTTCTTTCCA
TTTTCAGGCGATTTTAAAACGAACGATTTGCAAGGTGGCG
ACTTTACGCAGCCCAAACACTGGTACCCGTTTGCGGCCCC
CGAGTTCACTGGGCAGGTTGCAGGAGCGACGGCCGCCACT
CAGCCGGCGAACATCAGCCCTCCTATCGGCGAGACTAGAG
AGCAAATTAAGATGCCATCTGAGGTCAAAACCGAGAAAGA
TGTTGAAGAATACGGGAATGAAGAAAACAAGCCGCCGTCA
CAATATCACCTCACCGCTGGAACATCTTCCGTCCCCACCG
GGGTGAACTACTACACGCCATGGAACCCTAATTTCTGGCC
TGGACTGTCCCAAATTACGGCCCAAGCTAATATTTCCCAA
GCTCCCCCAACTCCCTCCGCTTCATCCCCATCTCTGTCTC
CGTCTCCCCCTGGAAATGGGTTCGGAAGCCCAGGATTTTT
TAGCGGAGGCACCGCGCAAAACATTCCCTCAGCTCAAGCG
CAAAGTGCACCCCGGAGCAGTGGGTCCTCCAGTGGAGGAT
GCAGTGATTCTGAGGAAGAGGAGACTCTGACTACTGAAGA
TTTGGAGCAGTTTGCGAAAGAGCTTAAACACAAGCGCATC
ACTCTGGGCTTCACGCAGGCAGATGTGGGACTCGCGCTTG
GAAACTTGTATGGCAAAATGTTCAGTCAGACGACAATCTG
CCGCTTTGAGGCTCTCCAACTTAGTTTCAAGAACATGTGC
AAACTGAAGCCGTTGTTGCAGAGGTGGTTGAACGAGGCCG
AAAACTCCGAGAACCCTCAGGATATGTACAAAATTGAACG
GGTGTTTGTCGACACGCGAAAAAGAAAACGAAGGACCAGC
TTGGAAGGCACAGTCCGTTCTGCTCTAGAGTCGTACTTCG
TGAAGTGCCCCAAACCCAACACTCTGGAGATAACGCACAT
ATCCGATGATCTAGGCCTGGAGAGAGATGTAGTGCGTGTA
TGGTTCTGCAACCGTAGACAGAAGGGAAAGCGTCTAGCTT
TGCCCTTTGATGACGAGTGTGTTGAAGCACAGTATTACGA
GCAGAGTCCACCACCTCCACCCCACATGGGTGGCACTGTG
CTCCCAGGTCAAGGCTATCCTGGACCAGCCCATCCTGGAG
GAGCCCCTGCCTTATACATGCCATCCCTCCACCGACCAGA
TGTCTTCAAAAACGGCTTGCACCCTGGTTTGGTGGGTCAT
CTCACCAGCTAACTTGCTCCAGGTGCTCACTAAAGTTTAT
AGAAAAGCTCCAAGCCAAGCTATGGATCAAATCAGCCATG
CTTATTATTCTTTTTTTTTTTTTTTGTAACACTGCATCTG
TTCATTTGGTTCTTTCCATACGTGCCTTGAGACACTTTAT
TGTTTAGTGTCTGGTTTTGACCATTCACACTAGCAACCTG
ATGGATTATTGTGTTATGAGTGCTTTGTTGAACTACTGCG
TTTGCACATGAAGTCATAGGCTCATTTTTATAGTTGTTTT
TAACAATGTTTGCTCATGTATCGGTTTTTATGTACATATA
TTTGTCTTAAACGTTTGATATTTGATGATTTACCAAAGTA
TATTTCCATATTTGTCTCCATAACTTTGTAGTTTACTCGT
ATTTGTGTGAACTGGCAGCAAATTCAAGACTTGATGAAAT
TTAAATTTGACTTTTTCTTTTTTCCTTTTTTTTTTTTTTT
TTTAATTTTAATGACGTGATGGATTTTTTTTTATTACGAT
TTGGAGAACTTTTATCAAATGATTTGACAAGAACATTAGT
CACTGTTCTTTTTCACCTCTCTAAATGCTTGCACTCTCCC
ATCTCCAAGTGAAATGCCTCTAGATGTACTCTTTGTCAGG
GTGGTTTTACATAAATATGCTGCCAGTTTGAAAGCCTCTC
TGTGGAGGTCATGTGCCTTATCTTTCAATGTCTCAATTCA
TGCATGCTCACCCGCAGTAAATTAAAGCCATATTTGATAA
TTTATTGAAACTCTGCTCTTGTCAACTCTTACAATAACTT
TTAGGTAGCAATTAAAACATTTTTCATTGACAGTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pou5f3-201 Contained in:
[BAC] CH73-205E12 (1)

Genome Resources: Vega_Trans:OTTDART00000044767 (1),  Ensembl_Trans:ENSDART00000065817 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC049295 (1) 2504 nt
GenBank:EH455632 (1) 910 nt
GenBank:EH481375 (1) 882 nt
GenBank:DT877540 (1) 819 nt
GenBank:CV490363 (1) 809 nt
GenBank:CD052615 (1) 735 nt
GenBank:CO352189 (1) 600 nt
GenBank:CD604687 (1) 386 nt
CITATIONS (2)