header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-1077
Transcript Name: npr1a-201
Previous Names: npr1a-001, ch73-130m10.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044197 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044197|OTTDARG00000031723|ZDB-GENE-060503-539 npr1a|OTTDARP00000034993 CH73-130M10.1-001 LG_none BX469936.11,FP017254.7 Danio rerio protein_coding KNOWN, 5171 bp
GATGGTTTGAGCTGTGAACTCGACGCGGAAACAAGAGTTT
TGCCTCAGCAATCACGAAACACGAATCAACTGATAAGAGA
CAACGGCGCGGATTTACAGAGGAATTATGACACCTTTCGA
CGGCCTAAACTGGGATTCGTAGTCCTTTCTATCCACTTTG
AAAATGGAATTGTTTCAGATGGGGCCGCTGAGGCTCACTC
TTCTCGTTCTTCTGAGTGGCGTGTCATTTGGAGTAGTTGA
ACTGGAGCCTGTGCCTGAAAACCAGCCTCAGTCTCCCAGT
GCCCATGCATCTCAAAAGAACATCACCCTGGCAGTTATCC
TGCCTCTCCACAACACGGAGTACCCTTGGGCTTGGCCCCG
TGTGGGCCCTGCTCTGTACTGGGCCCTGGAAAAGGTGAAC
TCTGATCCCAACCTGCTGGCAGGTTACCATCTACAACTGG
TTTTCAATAGCAGCGAAAACAAGGAAGGACTGTGTTCGGA
TTCAGTGGCTCCGCTTGTGGCTGTAGACCTGAAGTTCTCA
TACAACCCCTGGGCATTCATCGGACCAGGTTGTGACTACT
CGTCCTCACCTGTGGCACGTTTCACCACACACTGGGAGGT
TCCAATGATTACCAGTGGCGCAAGAGCACTGGGTTTCAAT
TTATACTCTTCCATTACCAACATCGGCCCGACACACAAGA
AGCTGGGCGAGTTTGTGCTCAGGATGCACCGGCATTTTGG
CTGGGACAAACACGCCATGCTCATGTTTAACGATAATAAA
AACGATGACCGGCCGTGTTACTTTGCCGTGGAGGGGCCGT
ACACACAGATGCGTGAAGACAACATCACAGCGGATGACTT
GGTGTTTAATGAGGATGAAGAACCCCTACGTTATGATGAG
CTTCTCCGGGATATCAGCCACAAAGCTCGTGTGGTGTATG
TCTGCTGCAAGTGGGAGACGTTTCGCAAGTTGATGGTGGA
GTTCTGGAGGCAGGGTTTTCCTCAGGAGGAGTACGCTTTC
TTCTTCATCGACCTGTTTGGACGCAGTTTGCAGAGCCATC
CTGCCAGACCATGGGCAAGAGGAGATGCTGATGACAATGC
AGCCAAAGAGGCCTTTAAAAGTGTGAAGATCCTGACCTAC
AGAGAGCCTCAGAACCCAGAGTACAAGGACTTTGTCTCCA
AGCTAAAGACAGAAGCCATGGATATGTTTAACTTCAACGT
GGAAGATTCTCTGATGAATCTGATTTCTGGGTCCTTCCAC
GATGGAGTCATGCTTTATTCTCATGCCCTGAATGATACTA
TGGATCGTTCGGGTTCGAGACCTCCGGGAGACGTGGTCAA
CAAGAGGATGTGGAATCGCACATATCATGGTGTTACCGGA
CTTGTGCAACTGGATGAGAATGGTGATCGGGAGATTGACT
TTGCTCTATGGGACATGACCGATACAAAGACAGGAGATTA
TCAGATTGTGTCTGTGTATAACGGCAGTCAGAAGCAGATG
ATTTTGGAGCCAGGAATGAAGGTGCACTGGCTGAAGGGAA
GGCCGCCTCCAGATATTCCTGAGTGTGGCTTCAAAAATGA
CAACCCTGCCTGTCTGGCAAAGACAGTCACCATGCACCAG
ATGATCTCCATAGTGGTGTGCTTCATCTTTATCATCATCG
TTACAGTCACAGTCTTCATATACAGGAAGCTGAAGTTGGA
GAATGAGTTGACCGCTCAGCTGTGGCGTGTGCACTGGGAG
GACATCCAGATGAGCAACACGGAGAAGGTCCTGCGCAGAG
CCTGCAGCAAACTCACCATATCCCTGAGAGGCTCTAACTA
TGGGTCACTGCTCACTATGGATGGAAACTTCCAGATCTAC
GCTAAGACTGGCTACTACAAGGGAAACATAACAGCCATTA
AGTATGTCAACAAGAAACGCATCGAGCTCACCAGGAAAGT
GCTGTTTGAACTCAAACATATGCGTGATGTCCAGAATGAG
CACCTTACCCGCTTTATCGGTGCTTGTATCGACCCACCAA
ACATCTGCATCCTCACTGAGTACTGCCCTCGAGGAAGCTT
ACAGGATCTGATGGAGAGTGAAGGAATCACGCTGGACTGG
ATGTTTCGCTATTCTCTCATCAATGACATTGTTAAGGGAA
TGGCGTTCCTCCACAACAGCGTCATCGTCTCCCATGGCAA
CTTGAAGTCTTCCAACTGCGTGGTGGACAGTCGCTTCGTG
CTGAAGATAACCGATTATGGGCTGGAAAGTTTCCACAAGG
ACAGCAATTTGGATGACGTGCATGCTTTCTATGCACGTCA
GCTGTGGACGGCCCCTGAGCTTCTGCGTGCTGATAATCCA
CCAGCGTGTGGAACACAGAAGGGTGACGTCTACAGCTTTG
GCATCATCCTGCAGGAGCTGGCTCTGCTGAAGGGCGTCTT
CTACCTGGAGGGCCCCTGTCTCAGCCCTAAAGAGATCATC
GAACGTGTGGTGGAGGGCCGCTGGCCATACCTGCGTCCCC
TACTGTGTCCTCAGAGTCACAGTGAGGAGATGGGACAGTT
GATGCTGCGCTGCTGGTCAGAGGACGTCAACGAGAGGCCA
GACTTCAGCCAGATTAAAGTACTGCTCCGCAAGAACAACT
GTGGATACGGCTCTAATATTCTGGATAACCTCCTGTCCCG
TATGGAGCAATATGCCAATAACCTGGAGGAGCTGGTGGAG
GAGAGGACACAGGCGTACCATGAGGAGAAACGAAAAGCTG
AAGCTCTGCTCTATCAGATTCTCCCACACTCAGTGGCCGA
GCAGCTGAAGCGAGGAGAGATGGTTCAGGCTGAAGCCTTT
GACTCTGTCACCATCTACTTCAGTGACATTGTGGGCTTCA
CAGCGTTATCCGCTGAAAGCACGCCTATGGAGGTGGTGAC
GCTGCTGAATGATCTCTACACTTGCTTTGATGCAATCATT
GACAATTTCGACGTATACAAGGTGGAGACCATCGGCGATG
CGTATATGGTGGTGTCAGGTCTGCCCGTGAGGAACGGCAA
ACTGCACGCCCGTGAGATCGCCCGCATGTCTCTGGCTCTG
CTGGAGGCCGTACACTCATTCAGAATCCGCCACCGACCAA
ACCTGCAGCTCCGTCTGCGCATCGGCATCCACAGCGGTCC
TGTGTGTGCAGGGGTGGTGGGTTTGAAGATGCCTCGTTAT
TGTTTGTTTGGTGACACAGTCAATACAGCTTCACGTATGG
AATCCAATGGAGAAGCTCTAAAGATCCATGTGTCAGAAGC
CACACGGGCCGTCCTGCAGGAGTTCAACTGCTTCCAGCTG
GAGCTCAGAGGAGATGTGGAGATGAAGGGAAAGGGCCGGA
TGAGGACGTATTGGCTGCTAGGAGAAATCAGCTCTAACAA
TGCCTAAAAACTAAATGACTGACAGAAAGAGCAACAAAAC
AAACACATCTAAACAAGTACTGGGACTGAAAGACCAGACC
AGAAATTCTTCAAAAAAAACTGGGTCCTGTTCATCTGTCA
TCACGCAGAGCTTAACATTCTTGCTTCACAGGAATCTCAC
TTTTTTTTTTTACCAAGTAAACGCACGAGAAAAGAAACAG
TACTTGAGCAGAATCCTTTAGACAAATGGAAGGTGGTATA
ACACAGTGCCAGATAAAGGTCTGATGAGTGTGTCCAGTGT
TTTTACGGGTCTTGTAGGGGTTTTTGTTTCATCATTGTAG
GTCTTCATCCAGATTTTCCTTCAGGAGTTGTATGGGTATG
TTTATTGTTCATACAGAGACACAGATCTGTAGTTTTTTTT
AGCCATGCAAAATGTTCCCGATTCTTCTTCTGGGACGCAG
GTCAATTCGAAACGCCTCTCTCTGCCAAATCTGATCCAGA
GGGTTTTGGGATGAAAGTTACGCACATTAGGAGAAATAAT
AATACATGTCAAGTATGATTAGACGTGTGCAATGATGGAT
TTTGTTCTTAGAATCCCTGCAGAAATCCACACGAGTATTG
ATGTTGCAATAGTGTTTCAGCTGAAACCAGCACAGGGTTG
ATTTTGTTTTTTGTTAATAGACAAATGGAGTTGTGTTTTG
TTTTTTTCATCCATCATTATTAGATTACGTTAATGTTAGT
GATTAATGATAAAGGATTAGTTCAAAATTCTGTCAATAAT
TACTCATTCTCATGTTGTTCCAAACCCTAAGGTATTTTGG
ATGAAATTTGAGAGCTCTCTTATTCTCCATATGCAGCAAT
GTTCCCGTCTCGTTCAAAGAACCAAATAACATCATCAAAA
CAGTCCATTTGTGTTGAGTGGTTCAATCAGAGTATTATGA
AGCTACAAGAATACTTTCGTGCACATATAAAACAACTCTT
TTTCTAGTTTTTCCGTCAGTGTCAGTAGTAAAGGGCGTCA
CACACCAGATGCACCACTCAGCTCCACGACACGGCGCGCA
CATGACAGTTAAAAGTATCGCACACCAGACGCGCACATTC
GCATGCTATTTAAAATGAAATTAATCAGATGGCGCTCTGG
AGAATAATGGATCTAATGGAGAATAATGGATCTTTCGGGT
TTCATCTAAAATATCCCCATTTGTCTTCTGAAGACAAACA
AATGTCTCTGGGGCTTGGACTTAATTAATATTTCACTCTA
AAACATTTGGGGTCTGTAAGATTTTGTAAGTTGATACATT
ACGTCAGTAAAAGCTGAAAGTTTATATCACTTTTAATATT
ACATTTCAATTCATGTTTTGTTTTTTCTTGATTTAATGGA
TCACAATTTCCACTAAATTATTAAAGGTGCTGTGTGTAAG
TTTGTGACTCTTCTGAAGCATAAAAATACTATATGTTTGG
AGATATTTAAGAACCTTGAGCAAGTGAACATTTTTGTTTA
TCTGAAGTCAGATACTTTACTTTGAAAATGTCTGTTACGT
TCTGGAACGCTTTCTTTGTTTCGTTTCTTTCAACCTGATT
CAGTATTTGATTCATTCAGTCAGGAAGGCTCACAAAGCAT
GCACCCATGACCGAAATGTGACCTCCAGTGGAAAGTTGCT
GACTCTGAAATAAGACGCAGATTCAGAGTTCCACGTGAGG
TTATAAATTAGCAAATAATATAAATATTATGAACACAAAC
ATTAGGTGAGCAGGTTACATTGTTACCCTGTGCCCTTACC
ACACGATACACAACAATATTTGCAGTGATTAGCAATTTAG
CTGTTTGCACC

npr1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA npr1a-201 5171
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
npr1a-201 Contained in:
OTHER npr1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044197 (1)
  • Ensembl_Trans:ENSDART00000136244 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH595702 (1) 985bp
    GenBank:EB940316 (1) 556bp
    CITATIONS (2)