ZFIN ID: ZDB-TSCRIPT-091203-71
Transcript Name: slc25a20-201
Previous Name: slc25a20-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045704 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045704|OTTDARG00000032679|ZDB-GENE-040426-1869 slc25a20|OTTDARP00000036072 slc25a20-001 LG_ CU693473.9 Danio rerio protein_coding KNOWN, 1424 bp
TGCGTCAGTTTAACAGTTCCGGGTGTGAATGTGGGTGAAG
GGTCGCTGAGAGACGCAGACGCTGCAGACTGACCGCTGAA
CCCCCCCGGTACTCCGCCGTTATTCTGCACGCTGCGGATC
CCACACGCTCAGTCCTCCGGGTTTGAGACTCTCCGACAGA
ATCATGTCGAAGCAGCAGCCGATCAGCCCCATGAAGAACT
TCTTCGCCGGCGGGTTTGGGGGAGTGTGCCTAGTGTTCGC
CGGACACCCGCTGGACACCATCAAGGTGCGCCTGCAGACG
CAGCCCAAACCCCGTCCTGGAGAAGTTGCGCAGTACGCCG
GAACATTCGACTGCTTCAAGAAAACACTGGCCAAAGAGGG
CGTGCGGGGTCTCTATAAGGGTATGGCGGCCCCCATCATT
GGTGTGACCCCGATGTTCGCCGTCTGCTTCTTCGGTTTTG
GCCTGGGGAAGAAATTACAGCAGAAAACACCCGACGACAT
CCTGACGTATCCGCAGCTGTTTGCCGCTGGTATGCTGTCA
GGTGTGTTCACAACAGCCATTATGGCTCCTGGAGAGAGAA
TCAAGTGTCTCCTGCAGATCCAGGCGGCGTCGGGGCAGGT
GAAGTACGCGGGGCCGATGGACTGTGTTAAACAGCTGTAC
AGAGAGAGCGGCATCAGGGGCATCTACAAGGGGACAGCAC
TCACACTCATGAGGGACGTGCCGGCCAGTGGGATGTACTT
CATGACGTATGAGTGGCTGAAGCACGCGCTGACACCAGAG
GGAAAGAGCCCCAGTGAGCTCAGCGTTCCCAGTATCCTGT
TCGCCGGTGGGATGGCGGGAATCTTCAACTGGGCCGTGGC
CATTCCTCCCGATGTGCTGAAGTCCCGCTTCCAGACGGCT
CCAGAAGGTAAATACCCCAATGGTTTCCGGGATGTGCTGC
GAGAGCTGGTGCGTGAGGAGGGCGTCCGCTCGCTCTATAA
GGGCTTCAACGCCGTCATGCTGCGCGCGTTTCCAGCCAAC
GCGGCCTGTTTCCTGGGCTTTGAGGTGGCCATGAAGTTCC
TCAACTGGATCGCTCCCAACCTGTGATGCGTGTGCTGGAG
AACACGCGTGAACAGTGGACACTGGCCGAGAACGCAGCTC
ACGCTAATGAACGCCTCGCTGGTTCCTCGACAGGATTTTA
ATCCAGTAGCTGGTGCCTTATAACAGACTGTGAACCGATT
TCTGCCTTCAGGGAAACTGAATGTTTATAACGCAACAGCA
AACCCGTCAAACGCTAGCAAACCTCTGTCAGGACATTAGC
ATATACGTTTACAGTATGGTCAGCCTTCAGCCCTCACGAC
AGGAATTCAGAACACAGTCAAGGCCTATCATCTTTTAATT
GTTCTGTTAATTATGTTTAATCATCACACTCATCATGTAA
ATAATTAAATGTTTATTGATCATT

slc25a20 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript slc25a20-002 (1)    Ensembl 757
mRNA slc25a20-201 1424
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc25a20-201 Contained in:
[Fosmid] CH1073-193A7 (1)

Genome Resources: Vega_Trans:OTTDART00000045704 (1),  Ensembl_Trans:ENSDART00000059140 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC062851 (1) 1426 bp
GenBank:EH602064 (1) 934 bp
GenBank:EE307497 (1) 900 bp
GenBank:EH580414 (1) 900 bp
GenBank:CN837881 (1) 883 bp
GenBank:EH560968 (1) 839 bp
GenBank:CK146212 (1) 747 bp
CITATIONS (2)