ZFIN ID: ZDB-TSCRIPT-091203-184
Transcript Name: slc25a20-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045705 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045705|OTTDARG00000032679|ZDB-GENE-040426-1869 slc25a20|OTTDARP00000036073 slc25a20-002 LG_ CU693473.9 Danio rerio protein_coding KNOWN, 757 bp
AGGGTCGCTGAGAGACGCAGACGCTGCAGACTGACCGCTG
AACCCCCCCGGTACTCCGCCGTTATTCTGCACGCTGCGGA
TCCCACACGCTCAGTCCTCCGGGTTTGAGACTCTCCGACA
GAATCATGTCGAAGCAGCAGCCGATCAGCCCCATGAAGAA
CTTCTTCGCCGGCGGGTTTGGGGGAGTGTGCCTAGTGTTC
GCCGGACACCCGCTGGACACCATCAAGGTGCGCCTGCAGA
CGCAGCCCAAACCCCGTCCTGGAGAAGTTGCGCAGTACGC
CGGAACATTCGACTGCTTCAAGAAAACACTGGCCAAAGAG
GGCGTGCGGGGTCTCTATAAGGGTATGGCGGCCCCCATCA
TTGGTGTGACCCCGATGTTCGCCGTCTGCTTCTTCGGTTT
TGGCCTGGGGAAGAAATTACAGCAGAAAACACCCGACGAC
ATCCTGACACGTGCCGGCCAGTGGGATGTACTTCATGACG
TATGAGTGGCTGAAGCACGCGCTGACACCAGAGGGAAAGA
GCCCCAGTGAGCTCAGCGTTCCCAGTATCCTGTTCGCCGG
TGGGATGGCGGGAATCTTCAACTGGGCCGTGGCCATTCCT
CCCGATGTGCTGAAGTCCCGCTTCCAGACGGCTCCAGAAG
GTAAATACCCCAATGGTTTCCGGGATGTGCTGCGAGAGCT
GGTGCGTGAGGAGGGCGTCCGCTCGCTCTATAAGGGCTTC
AACGCCGTCATGCTGCGCGCGTTTCCAGCCAACGCGG

slc25a20 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript slc25a20-002 757
mRNA slc25a20-201 (1)    Ensembl 1424
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc25a20-002 Contained in:
[Fosmid] CH1073-193A7 (1)

Genome Resources: Vega_Trans:OTTDART00000045705 (1),  Ensembl_Trans:ENSDART00000147151 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT645337 (1) 756 bp
CITATIONS (2)